➜ Fission (binary and multiple), regeneration and fragmentation are considered as methods of asexual reproduction because all of them involve only one parent and gametes are not formed in them. New individuals produced after cell division are always genetically identical or clone to their parents.
Answer:
Phobia is a result of associative learning that suggests human and other animals to learn fear in certain threatening objects or situations.
Explanation:
Phobia is a psychological condition that defines any kind of fear which will appear from certain type of objects and it scares intensely.
Several learning experiences creates fear when the particular person is expose to that condition.
These include some associative learning that is related with behavior.
This type of learning is usually based on stimuli which is generated through positive or negative consequences.
This type of learning which create phobia contain classical conditioning, Operant Conditioning, Cognitive social conditioning etc.
Answer;
-Nuclei acid
Explanation;
-Nucleic acids are molecules that allow organisms to transfer genetic information from one generation to the next. These macromolecules store the genetic information that determines traits and makes protein synthesis possible.
-Nucleic acids include DNA and RNA. These molecules are composed of long strands of nucleotides. Nucleotides are composed of a nitrogenous base, a five-carbon sugar, and a phosphate group.
Answer:
Here's what I get
Explanation:
The image below shows how a topographic map displays contours, contour intervals, and hachure marks.
The contour interval is 20 m and you are on the 340 m contour.
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
