1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VikaD [51]
3 years ago
6

Balenced chemical equations. (a)sodium + oxygen ____ sodium oxide​

Biology
1 answer:
Drupady [299]3 years ago
4 0

Answer:

Explanation:

4Na + O2 => 2Na2O

You might be interested in
Why fission, regeneration and fragmentation, all are considered as methods of asexual reproduction ?​
MrRa [10]

➜ Fission (binary and multiple), regeneration and fragmentation are considered as methods of asexual reproduction because all of them involve only one parent and gametes are not formed in them. New individuals produced after cell division are always genetically identical or clone to their parents.

8 0
3 years ago
Read 2 more answers
From an evolutionary perspective, phobias are a result of __________ learning, which suggests that humans and other animals that
Mice21 [21]

Answer:

Phobia is a result of associative learning that suggests human and other animals to learn fear in certain threatening objects or situations.

Explanation:

Phobia is a psychological condition that defines any kind of fear which will appear from certain type of objects and it scares intensely.

Several learning experiences creates fear when the particular person is expose to that condition.

These include some associative learning that is related with behavior.

This type of learning is usually based on stimuli which is generated through positive or negative consequences.

This type of learning which create phobia contain classical conditioning, Operant Conditioning, Cognitive social conditioning etc.

3 0
3 years ago
What biological macromolecule is made up of monomers like the one shown below? Answer Carbohydrate Fat Nucleic acid Protein
LekaFEV [45]

Answer;

-Nuclei acid

Explanation;

-Nucleic acids are molecules that allow organisms to transfer genetic information from one generation to the next. These macromolecules store the genetic information that determines traits and makes protein synthesis possible.

-Nucleic acids include DNA and RNA. These molecules are composed of long strands of nucleotides. Nucleotides are composed of a nitrogenous base, a five-carbon sugar, and a phosphate group.

4 0
3 years ago
Read 2 more answers
Match the following. Match the items in the left column to the items in the right column.
Allisa [31]

Answer:

Here's what I get  

Explanation:

\begin{array}{ll}\text{1. Contour interval}&\text{ the distance between contour lines of elevation}\\\text{2. Contour lines} & \text{ lines of equal elevation that display height, shape, and steepness} \\\text{3. Hachure marks} & \text{ teeth-like marks on contour lines that indicate a depression} \\\text{4. Topographic map} & \text{ also known as a contour map: shows shape, steepness} \\\end{array}The image below shows how a topographic map displays contours, contour intervals, and hachure marks.

The contour interval is 20 m and you are on the 340 m contour.

6 0
4 years ago
What is the mRNA that would be transcribed from this strand of DNA?
Illusion [34]

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

8 0
2 years ago
Other questions:
  • What is the most likely outcome for a cell that is not allowed to divide?
    10·2 answers
  • Help again please thank you! :)
    7·1 answer
  • You inject a hypotonic solution into a patient into her veins. what happens to her red blood cells
    9·1 answer
  • To which skeletal system do the carpals belongs
    5·2 answers
  • What is the symbol for carbohydrates
    8·2 answers
  • The specialized cells, that allow a squid to flash red light when threatened, provide the structural adaptation called __.
    14·1 answer
  • Help me pls ASAP !<br><br> (Extra points)
    5·2 answers
  • Why are light and chlorophyll needed for photosynthesis?
    5·1 answer
  • Please help, quiz is timed, didn’t study,
    8·2 answers
  • You are a volunteer at one of Pusat Pemindahan Sementara during this recent flood incident in Malaysia. Suddenly, a young lady c
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!