1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eddi Din [679]
3 years ago
7

What is a phosphorelated nucleoside?

Biology
1 answer:
Kaylis [27]3 years ago
4 0

Answer:

Nucleosides can be phosphorylated by a displacement reaction between phosphate and an electrophilic carbon of a nucleoside. To render a carbon electrophilic, the hydroxyl group must be converted into a leaving group of some kind (e.g., a halogen or sulfonate ester)

Explanation:

You might be interested in
The species of plasmodium that cause the disease malaria are found in
Eva8 [605]
<span>D Certain mosquitoes. To be specific anopheles mosquitoes. Genus Anopheles</span>
6 0
3 years ago
Read 2 more answers
40 points HELP!! I will mark brainliest and give 5 stars! :) Click the attached link to see the work I need to be done
Korolek [52]

Answer:

can't open the pdf

Explanation:

try resending it again

4 0
3 years ago
Read 2 more answers
The tRNA for GUCAUCGAUCGAUCGGAUGCC
Lapatulllka [165]

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

3 0
3 years ago
The wall of the alveolus (air sac) in the lung is composed of which type of epithelium?
lesantik [10]
Psuedostratified columnar epithelium
5 0
4 years ago
Morgan obtains a score on a screening device for depression, which indicates the presence of significant depression. Morgan's ps
Allisa [31]

Answer: Recommend further assessment.

Explanation:

Psychologists can usually tell if you have depression by asking you specific questions and doing a physical exam. Psychologists may, however, ask for lab tests to rule out other diagnoses. They will likely do blood tests to check for medical conditions that may cause depressive symptoms.

8 0
3 years ago
Other questions:
  • One of your friends is reading a newspaper article, which notes that, in rats, there is a positive significant relationship betw
    9·1 answer
  • Two species of meadowlark have different mating calls that lead to reproductive isolation. What type of isolation does this exam
    14·2 answers
  • Which circuit of the cardiovascular system is responsible for sending blood to the kidneys, stomach, and pelvic regions?
    14·2 answers
  • In simple dominance, what is the result when a dominant allele pairs up with a recessive allele?
    9·2 answers
  • Which fungi are enclosed by cell walls containing the polysaccharide
    13·1 answer
  • Why are all the Miller-Urey experiments essential to the theory of evolution?
    14·1 answer
  • Which type of fungus is shown in the diagram ?
    15·1 answer
  • You have two tubes (I and 2) that initially contain the same concentration of starch. However, you add one microgram (1ug) of am
    13·1 answer
  • How often should observations be made in a simulation of natural selection??
    12·1 answer
  • Will give a lot of points and crown
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!