1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
creativ13 [48]
3 years ago
8

Bonjour aidez moi svp

Geography
1 answer:
qaws [65]3 years ago
4 0

Answer:

Im so sorry i dont speak french

Explanation:

You might be interested in
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
If magma or lava cools quickly, the resulting igneous rock will have ________.
Elden [556K]
The answer is very small crystals
7 0
3 years ago
If a country has a high HDI, what might we expect its birth, death and population growth rates be like?
Cloud [144]
Birth rates: moderate
Death rates: low
population growth: high
5 0
3 years ago
What is a ruler like symbol used to measure distance on a map?
nydimaria [60]
A ruler-like symbol used to measure distance on a map is a scale. It shows the ratio of the distance on the map to the actual distance. Hope this helps! :)
4 0
3 years ago
What is sheerwood? And why is it important.
boyakko [2]

Local shear failure occurs when the shear stresses parallel to the grain, i.e. shear stresses acting in the longitudinal-tangential (LT) or longitudinal-radial (LR) planes, exceed the shear strength of the beam. The shear strength of a wood member is difficult to quantify.

3 0
3 years ago
Other questions:
  • if you were planning to open a sporting goods store, in what ways could gis technologies help you choose a good location? discus
    8·1 answer
  • The _____ was the major project undertaken by the federal government in washington during depression
    6·2 answers
  • A geologist looks at a map to determine which of two areas would experience more chemical weathering. Area 1 is on the coast of
    12·2 answers
  • Throughout its history, how many people are estimated to have died from mining accidents and mining-related illnesses due to wor
    10·2 answers
  • Which is NOT a major factor in determining the climate of Europe?
    13·2 answers
  • Where is earth's fresh water found and stored?
    15·2 answers
  • Why did Portugal begin to explore the coasts of South America and Africa in the 1400s? Edge2020​
    12·1 answer
  • PLEASE HELP ME PLEASE!!~~~ CORRECT ANSWER GETS BRAINLIEST!~~
    9·1 answer
  • Can you think of other examples of things you might understand theoretically, but not practically?
    5·1 answer
  • The main characteristic of knowledge according to Nyaya, is that it illuminates and reveals what exists.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!