1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vika [28.1K]
3 years ago
15

Which symptom would an individual with a narrow foramen most likely experience?

Biology
2 answers:
asambeis [7]3 years ago
5 0

Answer:

back or neck pain. numbness or weakness of the hand, arm, foot or leg.

Svetllana [295]3 years ago
4 0

A person with a narrow foramen would most likely experience symptoms such as:

  • Weakness.
  • Numbness
  • Burning and tingling sensation.

<h3>What results in a narrow Foramen?</h3>
  • It is known as foramen stenosis.
  • Results from open spaces being in the spine narrow.

When a person is suffering from this condition, they will experience a host of problems in their arms and feet such as numbness, weakness, and a burning sensation.

Find out more on the foramen at brainly.com/question/9803103.

You might be interested in
A recent commercial advertised for a wristband that claimed to restore health and balance by taking advantage of natural frequen
Zarrin [17]

Answer:

The answer is - It was not a controlled experiment

Explanation:

A control experiment can be defined as that in which the all variable is kept constant and intact and then used as a standard of comparison or measurement to the experimental component.The commercial showing several people initially struggling to balance without the wristband and then balancing fine with the wrist band is not a controlled experiment.

7 0
3 years ago
Mushroom fungus spore cell prokaryotic or eukaryotic
Agata [3.3K]
Fungi are eukaryotic organisms that comprise one of the kingdoms of life.<span> Most fungi are multicellular. As eukaryotic organisms, fungi possess cells with organelles, which are structures surrounded by membrane.

hope this helps

thus, mushroom fungus is eukaryotic!!!</span>
7 0
3 years ago
Weakness in what muscle can lead to chronic back pain?
Airida [17]

Answer:

weakness of core muscle can lead to chronic back pain

4 0
3 years ago
1. If the ability to taste PTC were controlled by only two alleles: one dominant (T) and one recessive (t), would there be any w
maw [93]

Answer:No

Explanation: there would not be a way to distinguish between Tt and TT without mating or DNA analysis because T is dominant in Tt, therefore has the same physical characteristics as TT.

8 0
3 years ago
Which are examples of ecosystem diversity?
natita [175]

Answer:

Deserts.

Forests.

Large marine ecosystems.

Marine ecosystems.

Old-growth forests.

Rainforests.

Tundra.

Coral reefs.

Explanation:

3 0
2 years ago
Read 2 more answers
Other questions:
  • What natural disaster was causes by the eruption of Mount st. helens in Washington state?
    5·2 answers
  • The motion permitted at a joint ranges from ____________ , such as where some skull bones interlock at a suture, to ____________
    14·1 answer
  • What is cellular respiration? Include the reactants (inputs), products (outputs) and biological importance of this process in yo
    8·1 answer
  • Give one example of how cooperation can help organism survive
    15·1 answer
  • Which body did the National Park Service Organic Act establish?
    10·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • How did the carbon, hydrogen and oxygen atoms in glucose and fructose combine to form sucrose? Include in your description which
    10·1 answer
  • you decided to make bread you mix together the yeast mixture and set it on the table overnight but when you wake in the morning
    10·1 answer
  • The graph below represents the effect of enzyme concentration on the reaction rate.
    15·1 answer
  • What other ways can organisms be classified?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!