1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Komok [63]
2 years ago
15

Evidence that perpetrators do not see or realize they are leaving behind or

Biology
1 answer:
Ksju [112]2 years ago
7 0

Evidence that perpetrators do not see or realize they are leaving behind or carrying away from a crime scene is known as Trace evidence.

<h3>What is a Crime Scene? </h3>

A crime scene is an environment or a place where perpetrators commit an offense and evidence can be gathered by the Forensics.

According to Locard's principle, he formulated a principle that every contact in a crime scene usually leaves a trace that can be left behind or carried away from the crime scene.

Therefore, we can conclude that the evidence that perpetrators do not see or realize they are leaving behind or carrying away from a crime scene is known as Trace evidence.

Learn more about the Crime scene here:
brainly.com/question/10702774

You might be interested in
3. In a field of sugar beets in Georgia the net primary productivity is 120 grams/m^2/day, and the
konstantin123 [22]

Answer and Explanation:

Available Data:

  • 1 gr beets = 2,000 cal
  • NPP = GPP – Respiration = 120 grams/m2/day
  • NPP= Net primary productivity of a system
  • GPP= Gross productivity of the producers
  • Respiration loss 25% of NPP
  • Insolation energy is 800 calories/cm2/day
  • % Efficiency of Photosynthesis = (NPP/Insolation Energy) X 100

1) Find the gross productivity of the sugar beets.

We need to calculate the GPP, which equals NPP - Respiration rate. The respiration loss is 25% of the NPP. This is:

100% NPP--------------- 120 g/m²/day

25% NPP ----------------X = (25 x 120)/100 = 30 g/m²/day

Now that we know the values of NPP and respiration rate, we can calculate the GPP.

GPP = NPP - Respiration

GPP = 120 (g/m²/day) - 30 (g/m²/day)

GPP = 90 g/m²/day

GPP = 0.009 g/cm²/day

2) Using the NPP, calculate the efficiency of photosynthesis for the sugar beets.

% Efficiency of Photosynthesis = (NPP/Insolation Energy) X 100

We know the NPP, but this value is calculated in g/m²/day, while the Insolation energy is in g/cm²/day. We need to calculate the % Efficiency of Photosynthesis in cm. To do that, we must transform the information.

So if 1 m² = 10,000 cm², then:

10,000cm²----------120 grams/m²/day NPP

1 cm²---------------- (1 x 120) / 10,000 = 0.012 grams/cm²/day NPP

We also know that 1 gr beets = 2,000 cal, and that the Insolation energy is 800 calories/cm²/day

So we need to transform Insolation energy from calories/cm²/day to grams/cm²/day, so:

2,000 calories ----------------- 1 gr beet

800 calories/cm²/day---------X = 0.4 gr beet.

% Efficiency of Photosynthesis = (NPP/Insolation Energy) X 100

% Efficiency of Photosynthesis = (0.012 (gr/cm2/day) /0.4 (gr/cm2/day)) X 100

% Efficiency of Photosynthesis = 3 gr/cm2/day  

8 0
3 years ago
Which group of algae is believed to be the ancestor of land plants?
ycow [4]

Answer:

<u>stonewort, and many green algae such as the Spirogyra.</u>

Explanation:

  • As it was believed that the land algae were believed to be evolved from the stonewort plant and the blue-green algae like the cyanobacteria and the spirogyra that colonized the lands some 500 mn years ago was a freshwater alga.
  • After which the first land plants occur about 470 million years ago, and they were in the form s of moss and liverworts of the vascular in origin.
7 0
3 years ago
Calculate USDA grade for a 330lb barrow with average muscling and 1.0” <br> backfat:
Aleks [24]

Answer:

is there a picture

Explanation:

5 0
3 years ago
Read 2 more answers
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
What is the answer for this plz????
Artemon [7]

Answer:

Alkali metals are any of the elements found in Group IA of the periodic table (the first column). Alkali metals are very reactive chemical species that readily lose their one valence electron to form ionic compounds with nonmetals. All elements in the alkali metal group occur in nature.

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • Through , larger molecules are formed
    9·1 answer
  • Of the chemicals that fall under the tsca ________% have been tested for toxicity and ________ have been tested for endocrine, n
    10·1 answer
  • Humans are often referred to as "carbon-based" life forms. given that humans breathe oxygen, shouldn't humans be referred to as
    15·2 answers
  • What conditions are possible reasons for declining genetic diversity of a species? Select all correct answers.
    13·1 answer
  • Two species of meadowlarks have different mating calls that lead to reproductive isolation. What type of isolation does this exa
    12·2 answers
  • Cell theory states that all living things contain one or more cells. Why do you think cell theory meets the definition of a scie
    7·1 answer
  • How does an increase in cell volume impact the diffusion of materials through the cytoplasm?
    8·1 answer
  • How water quality changes from source of a river to the mouth
    11·1 answer
  • The magnets point North when the Earth's magnetic field has (p2)<br><br>need some help :)​
    9·1 answer
  • The principle of competitive exclusion states that A. two species cannot coexist in the same habitat. B. competition between two
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!