1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leviafan [203]
2 years ago
8

The satellite photo below shows San Francisco, California, which has many miles of coastline and an inland bay. Which area of th

e coastline has most likely experienced the greatest effect of erosion from waves over hundreds of years? '
A. Area N B. Area P C. Area S D. Area T

Biology
1 answer:
Alex2 years ago
6 0

Area S is region which experienced more erosion from waves due to its presence on the bank of ocean.

<h2 /><h3>Erosion</h3>

Area S is the area of the coastline that is most likely experienced the greatest effect of erosion from waves over hundreds of years because area S is located on the coastline of pacific ocean. Those areas which are located on the bank of ocean experience more erosion due to waves.

This is because the waves continuously hitting the land as compared to those regions which experience less erosion due to less hitting of waves so we can conclude that area S is region which experienced more erosion from waves due to its presence on the bank of ocean.

Learn more about erosion here: brainly.com/question/1028727

Learn more: brainly.com/question/26218239

You might be interested in
Which is the best example of a hypothesis leading to new experimental
Serjik [45]

try it first then do it over again until it works

3 0
3 years ago
Why are indexes better than simple measurements for comparing fossil specimens?
timurjin [86]
They are better because they are for comparative use for instance hair color to finger nails they both grow but onto separate parts of the body. 

Hope this helps [: 
5 0
3 years ago
How does the Gulf Stream affect weather in the United States?
Solnce55 [7]
The answer is B. brings cooler temperatures from the topics
5 0
3 years ago
Suppose that a patient is diagnosed with a new disease caused by the buildup of waste material in the body’s cells. Which organe
Misha Larkins [42]
I believe the organelle that is most likely malfunctioning in the patients cells are the lysosomes.
7 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • Mitochondrial DNA is used to follow maternal inheritance and sequences on the Y chromosome is used to follow paternal inheritanc
    10·1 answer
  • The trachea is ________ (anterior/posterior) to the esophagus.
    13·1 answer
  • Jenna says that an example of homeostasis is when body temperature is maintained at about 37° C. Allen says homeostasis is when
    12·1 answer
  • A few members of a population are immune to a disease that kills many others.
    8·1 answer
  • 2. Mr. Simpson has blood type ABRh+ and his wife type ORh+. Mr. Doodle has type ARh- and his wife type ORh+. The Simpsons and Do
    7·1 answer
  • A city is most likely to experience a change in weather under which of the following conditions?
    8·1 answer
  • Discuss the implications of neuroplasticity on the promise of treatments for injuries or conditions. Also, because the brain cha
    10·1 answer
  • Determine if the gene for this trait resides on an autosome or sex chromosome. Use evidence to support your answer
    14·1 answer
  • Briefly outline the progressive evolution of the respiratory and circulatory systems in vertebrates
    8·1 answer
  • 3. Honey is a(n) hypotonic/isotonic/hypertonic solution compared to the cells of the zucchini
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!