Cells, the basic unit of life, are derived from spontaneous generation.
The answer is A, 'a mammal' because it goes with the copulative verb 'to be', i. e., 'is'.
Schemas refers to a cognitive frame work which help humans to organize and give interpretations to information obtained both from within and from the external enviroment. Schema guide human cognitive processes and behaviour. Schema helps in structuring our memories by acting as a glue which hold all the information we have gathered together. Shcema is used in recognizing new experience and in relating it with old experiences. Schema affects humans' perception, encoding, memory recall, etc.
If
you check the barometric pressure and find that [sic] it is reading
only 920 millibars ... two effects possibly responsible for this lower
than average reading are 1) elevation (~2500' MSL) or 2) a LOW
pressure weather system such as a mid-latitude or tropical cyclone. Also <span>A storm is approaching or barometer is read over a mountain</span>
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: