1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
3 years ago
7

Bio what’s the answer?? help

Biology
1 answer:
Margaret [11]3 years ago
8 0
It’s the first one!

compact bone is a dense bone with a bony matrix that is solidly filled with arya if ground substance and inorganic salts, leaving only tiny spaces (lacunae) that contain osteocytes, or bone cells. Immature compact bone DOES NOT CONTAIN OSTEONS and has a woven structure.

hope this helps!
You might be interested in
What part of the cell does 1 represent
MatroZZZ [7]

Answer:

1 represents Golgi apparatus

Explanation:

6 0
3 years ago
What is the definition of galactic center and galaxy cluster ?
Ber [7]

Answer:

The Galactic Center (or Galactic Centre) is the rotational center of the Milky Way galaxy; it is a supermassive black hole of 4.100 ± 0.034 million solar masses, which powers the compact radio source Sagittarius A*.

7 0
3 years ago
Need help asap please and thank you
yanalaym [24]
B goes to the second one A goes to the first one D goes to the third one and C goes to the fourth one I believe. I hope that helps
7 0
3 years ago
What is the value of a bonobo
Goshia [24]
closest relative like a chimpanze or monkey
5 0
3 years ago
Read 2 more answers
Why is it significant that the four newly formed cells differ in chromosome content
liraira [26]

because of the explanation

4 0
3 years ago
Read 2 more answers
Other questions:
  • Which igneous rock and sedimentary rock have quartz as part of their composition
    11·1 answer
  • What plant has the binomial (scientific name Ilex aquifoliam? plss​
    14·1 answer
  • Kidneys are part of the excretory system in a human body. They purify the impure blood and send it back to the rest of the body.
    5·2 answers
  • What single cell do specialized cells develop from?
    14·2 answers
  • swollen lymph nodes can be an indication of a: too much fluid in the body b: too little fluid in the body c: an infection d: no
    5·1 answer
  • What is the process in which two gametes unite
    12·2 answers
  • Algal cells are placed in an isotonic solution. Additional amounts of solutes are slowly added to the solution. What happens to
    14·1 answer
  • Ediments that consist of mineral grains that were eroded from continental rocks are called _____.
    6·2 answers
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Markette Stotts: Attempt 1 Question 1 (4 points) Solve for the variable. Show all work. You cannot earn partial credit for incor
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!