Rachel Carson, one of the most world famous American Ecologist was among the first one who finds out about the Danger in Using Pesticides.
Not only that, she wrote several books about many environmental concerns that started people's general Awareness of Environmental problems, such as. The silent spring and The sea around us.
Explanation:
Antony van microscopist is best celebrated for locating bacterium and making over five hundred straightforward microscopes. He additionally discovered sperm cell cells, blood cells, protists and microscopic nematodes. He was created one amongst the primarily recorded observations of bacterium once he studied the plaque from his teeth and also the teeth of many others.
Ed Laurent could be an abstraction biologist United Nations agency develops and delivers cooperative, science-based recommendations and tools that modify the implementation and analysis of conservation activities.
Alexander Humboldt United Nations agency was 1st to explain ecological gradient of angular distance variety increase toward the tropics in 1807.
Answer:
The squirrel, robin, and field mouse
Explanation:
A producer is what gets its energy directly from the sun (usually a plant) and the squirrel, robin, and field mouse all eat the plant seeds, which get energy from the sun .
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
angle of incoming sunlight
Explanation:
The single feature that primarily determines the variation in climate in different parts of the world is the angle of incoming sunlight.
- Climate is simply an extended study of weather over a long period of time.
- The elements of weather like temperature, pressure, rainfall all conditions climate.
- The angle of incoming sunlight is by far the most important factor that determines climatic patterns on the earth.
- Around the equator, the sun is overhead and these regions are usually hot driving a wide range of weather phenomenon.
- The polar and temperate regions receive diffused sunlight because the sun is at an angle there.
learn more:
Sunlight brainly.com/question/1739812
#learnwithBrainly
Answer:
Cell membranes are semi-permeable, which works like a sieve that determines what enters and leaves the cells.
Explanation:
It is semi-permeable and it allows molecules to diffuse inside.
<em>Feel free to mark it as brainliest :P</em>
