1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naily [24]
2 years ago
15

Pls hurry with answer

Biology
1 answer:
gogolik [260]2 years ago
6 0

Answer:

Showers

Explanation:

I watch the news and weather

You might be interested in
Diffusion and osmosis are both forms of
Kruka [31]

Answer:

D

Explanation:

Diffusion and osmosis are both passive forms of transport because there is no energy need to transport something such as water from an area of high pressure, to an area of low pressure.

4 0
3 years ago
Read 2 more answers
A/an _____ agent is a substance that has the potential to cause another substance to be oxidized.
ludmilkaskok [199]
B , an oxidizing agent is a substance that has the potential to cause another substance to be oxidized
5 0
3 years ago
I really need help w this question. There is more than one right answer.
beks73 [17]
Let's refer to the statements as A through F.

A. The diagram shows the ocean absorbing "90" and releasing "88". That means the ocean absorbs more than it releases (90 > 88), so acts as a "sink", a place where carbon is stored. (TRUE)

B. The dashed red arrow on the right labeled Fossil Fuel Combustion shows a transfer of carbon into the Atmosphere. (TRUE)

C. The diagram shows "Primary Production and Respiration" as coming from "Vegetation and Soils", so animals are not the sole contributors of CO₂ from respiration. (FALSE)

D. The blue arrows show exchange of atomospheric CO₂ with oceans and land. (TRUE)

E. While "Changing Land Use" contributes a net decrease of atmospheric CO₂, that is more than balanced by "Combustion and Industrial Processes." The net "Anthropogenic flux" appears to be positive into the Atmosphere. (FALSE)

F. The blue arrow into Vegetation and Soils is 120, the blue arrow out is 119, so soils take in more CO₂ by natural processes than they release. Likewise, "Changing Land Use" contributes a net increase in CO₂ in the soils and vegetation. Hence, soils do take in more than they release. (TRUE)
8 0
4 years ago
Mutations in dna sites such as promoters and operators can act only in cis
a_sh-v [17]
This is true.
An easy way to remember this is that Cis-acting elements are physically linked to a set of structural genes. So promoters and operators are physically linked to the gene they express. They are cis acting because they are on the same strand as the structural gene they control.

On the other side, trans means that they can come from somewhere else and act. A good example of this would be regulatory proteins. These could be expressed somewhere else (or on a different strand) and then bind and affect transcription. 
4 0
3 years ago
The surface of the villi in the small intestine is covered by a single layer of epithelial cells called enterocytes. Enterocytes
Paul [167]

Answer:

B.

Explanation:

basically when the stem cell in the crypts divides they formed daughter cells. One of the   daughters from each of the original divided stem cells  usually divides to form another stem cell, while the rest forms transit amplifying cell.These amplifying cells are  capable of dividing multiple times until they are evenly differentiated(designated to specific function) e.g top globlet cells, enterocytes, tuft cells etc.

3 0
3 years ago
Read 2 more answers
Other questions:
  • What environmental worldview is seen by critics as focused on short-term economic benefits with little regard for long term harm
    6·1 answer
  • Most species of cyanobacteria are enclosed in a _____.
    12·1 answer
  • Help...........................
    8·1 answer
  • The organisms in a typical backyard are likely to include bacteria, grass, shrubs, trees, insects, spiders, birds, and small mam
    12·1 answer
  • Draw a circle around which bond needs to be
    9·2 answers
  • Where is caulerpa native
    5·1 answer
  • In what way are gravitational and electrical forces similar?
    10·2 answers
  • Use the dichotomous key to identify these plant leaves. Leaves from which plant are shown? pine catalpa dogwood maple
    9·2 answers
  • WILL GOVE BRAINLY!!
    5·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!