1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Musya8 [376]
2 years ago
10

Consider the following statements. Which of these statements is the hypothesis?

Biology
1 answer:
gogolik [260]2 years ago
6 0

This is the image with The answer.

I hope this helped

You might be interested in
1. What is the term that refers to the change that happens in a living organism because of a stimulus?
Studentka2010 [4]

Answer:

The answers are :-

1.What is the term that refers to the change that happens in a living organism because of a stimulus?

<u>c)</u><u> </u><u>stimulus</u>

2. The best example of an organism's response to a stimulus.

<u>d)</u><u> </u><u>dog barks when there are </u><u>fireworks</u><u>.</u>

3. The process by which living organisms stay the same.

<u>b)</u><u> </u><u>homeostasis</u>

4.How does a one-celled organism grow?

<u>c) It </u><u>divides</u>

<u>PLZZ</u><u> </u><u>MARK</u><u> </u><u>ME</u><u> </u><u>AS</u><u> </u><u>BRAINLIEST</u><u> </u>

4 0
2 years ago
WILL MARK BRAINLIEST
Svetlanka [38]
1. eye color is an inherited trait
2.photosybtheis by plants
3. either biome or habitat
4.XY
5.manyfactures new blood cells
6. large intensity and kidney
7.idk
6 0
3 years ago
Read 2 more answers
Phytoplankton form the base of food webs, but are only present in the upper few hundred meters of the ocean. A number of factors
Ksenya-84 [330]

Answer:

The correct answer is d. Oxygen

Explanation:

Phytoplanktons are responsible for the fixation of approximately half of the global carbon therefore seawater has high CO2 concentration which is required by phytoplanktons to make their food.  

They are the primary producers of oceans and they are responsible to support the food chain of oceans. Factors that can limit their growth are mainly sunlight and nutrients like phosphorus, nitrogen, etc.

As phytoplanktons are photosynthetic they release oxygen itself as a byproduct therefore oxygen is not a limiting factor to phytoplanktons. So the right answer is d.

6 0
3 years ago
Many receptor tyrosine kinase pathways have mapk as a downstream signaling component. mapk can phosphorylate target proteins. wh
Lapatulllka [165]

A protein kinase that is specific to the amino acids serine and threonine is known as a mitogen-activated protein kinase (MAPK or MAP kinase; also known as a serine/threonine-specific protein kinase).

<h3>Mitogen-activated protein kinase :</h3>

A small number of cell surface receptors can ultimately generate a large intracellular response due to activation of kinase cascades.

In order to trigger an appropriate physiological response, such as cellular proliferation, differentiation, development, inflammatory reactions, and death in mammalian cells, MAPK pathways relay, amplify, and integrate information from a variety of stimuli.

Tyrosine phosphorylation, specifically numerous tyrosines on each RTK in the dimer, is how cross-linking triggers the tyrosine kinase activity in these RTKs. The term "cross-phosphorylation" refers to this action.

The activation of a MAPKKKK or MAPKKK by stimulation of plasma membrane receptors is the initial stage of signal transduction. The MAPKKK then phosphorylates two serine or threonine residues in the S/T-X5-S/T (X is any amino acid) motif of its activation loop, activating a downstream MAPKK.

Learn more about MAPK here:

brainly.com/question/23449262

SPJ4

3 0
2 years ago
Estas de acuerdo con la aplicación del principio de la física en ecología:¨la energía no desaparece ni se destruye, solo se tran
saveliy_v [14]

Answer:

Esta afirmación es correcta ya que la ley de conservación de la energía es también aplicable a sistemas vivos  

Explanation:

La ley de la conservación de la energía (la cual es la primera ley de la termodinámica) indica que la energía no se puede crear ni se puede destruir, solamente se transforma, de un tipo a otro. La ley de la conservación de la energía es de vital importancia para entender la existencia del mundo natural. En ecología, la energía fluye de un nivel trófico a otro en forma de biomasa, es decir, dentro de la cadena alimentaria. Esta energía no se puede crear ni destruir sino que es almacenada en los organismos, los cuales representan sistemas abiertos que intercambian materia y energía con el medio. Una vez dentro del organismo, una parte de esta energía es transformada (en plantas, por ejemplo, la energía es convertida en enlaces químicos durante la síntesis de carbohidratos), mientras que otra parte de la energía se elimina al exterior (por ejemplo, se disipa en forma de calor), pero la energía no se crea ni se destruye.

3 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • What makes a fungal cell unique
    7·2 answers
  • The theories on the expansion of the universe ?
    6·1 answer
  • Why would a lack of neurotransmitters change the function of the brain?
    11·2 answers
  • Explain the role of organic compounds in cellular respiration
    14·1 answer
  • Which of the following can be explained with science? (4 points) Select one: a. Plant growth b. Career options c. Moral value d.
    12·2 answers
  • Salazar made a chart to describe some relationships among species. Relationships among Species X Y Boxing crabs gently carry ane
    13·2 answers
  • Describe 3 different ways that antibodies inactivate antigens
    5·1 answer
  • Apakah hubungan antara keamatan cahaya dengan kadar transpirasi?<br>​
    11·1 answer
  • Suggest two ways you could determine if two species are mimics in nature.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!