1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kifflom [539]
2 years ago
14

A scientist recently discovered a pond organism that is unicellular, contain

Biology
1 answer:
Inga [223]2 years ago
5 0

A pond organism that is unicellular, contains membrane-bound organelles and possesses a flagellum is a PROTISTA. It is a unicellular kingdom.

The Protista kingdom is composed of eukaryotic single-celled unicellular organisms.

Flagellated protists are microorganisms having a tail-like projection known as flagellum.

The flagellum is a structure used for motion, thereby, in general,  flagellated protists are found in moist environments (e.g., ponds, fresh-water, etc).

Learn more about the Protista kingdom here:

brainly.com/question/5186929

You might be interested in
The musculoskeletal system, a collaboration
oee [108]

Answer:

D. Movement

Hope this helps :)

6 0
3 years ago
Which one of the following is a characteristic of a metal?
alex41 [277]
B) Most metals conduct heat readily. In pure elemental forms, they neither have basic or acidic properties. Other properties include malleability, high melting points, high densities, and electric conduction.
4 0
3 years ago
Read 2 more answers
This mineral is composed only of one element, carbon. It is listed as the hardest on MOHs scale of hardness. Which mineral is th
Allisa [31]

Answer:

a

Explanation:

8 0
3 years ago
Read 2 more answers
A farm is at the top of a drainage basin, what is one way this can affect the runoff water downhill from the
Tems11 [23]
If the farm uses pesticides and herbicides that will runoff into the water leading to contamination of that water.
6 0
3 years ago
Which of the following best describes the cell cycle?
zhenek [66]

Correct answer: B). Cells spend the most time in interphase, where they grow and their DNA replicates.

The cell spends its most of the time in the interphase, during this phase of growth, cell continues to grow and carry out its metabolic activities which are necessary for regular growth and maintenance.

During this phase of the cell cycle, a lot of protein is synthesized in order to double its size. The important changes that occur in this phase include DNA duplication and division of chloroplast and mitochondria.

Hence, the correct answer would be option B.








5 0
3 years ago
Read 2 more answers
Other questions:
  • Gas giants have atmospheres composed primarily of helium and _______.
    15·2 answers
  • Either type of reproduction will result in the continuation of a species, but one method results in genetic variation as well. A
    12·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Why is guys attitude different from girls
    12·2 answers
  • A young child develops type 1A diabetes. The parents ask, They tell us this is genetic. Does that mean our other children will g
    13·1 answer
  • Most aquatic organisms can survive only within a specific pH range. An increase in the number of hydrogen ions (H+) in a lake wi
    12·1 answer
  • What kind of skins is this please help​
    8·1 answer
  • Giving BRIANLIEST PLZ HELP AND ANSWER ASAP!
    8·1 answer
  • Calico cats are almost always female because the gene for coat color is
    15·1 answer
  • . Which of the following is NOT a characteristic of life?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!