All categories

3 years ago

A.

Biology

2 answers:

scZoUnD [109]3 years ago

8 0

The answer to this question is c

Savatey [412]3 years ago

3 0

Answer:

Explanation:

You might be interested in

How does he process of cellular respiration maintain homeostasis at the cellular level?.

777dan777 [17]

The process of homeostasis is retained at a cellular level by making the cell get rid of waste materials such as carbon dioxide. Carbon dioxide is produced in cellular respiration. Other waste materials are utilized to make oxygen and protein.

6 0

3 years ago

All the biotic and abiotic factors in an area together make up an ecosystem.<br> T OR F

Helen [10]

The right answer is T. <span>All the biotic and abiotic factors in an area together make up an ecosystem.

I hope this helps. Have a nice day!</span>

3 0

4 years ago

Read 2 more answers

Which part of the brain processes inputs received from the cerebral motor cortex, brain stem nuclei, and various sensory recepto

a_sh-v [17]

The answer is cerebellum. By processing and interpreting impulses from the motor cortex and brain stem nuclei as well as sensory pathways, the cerebellum provides the precise timing and appropriate patterns of skeletal muscle contraction for smooth coordinated movements and agility needed for daily living. It also plays a poorly understood role in cognition. Cerebellar activity occurs subconsciously (e are not aware of it).
<span />

5 0

3 years ago

Read 2 more answers

AUUUAACUGUUCUGUCUAGAG

Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0

3 years ago

Population density is the number of individuals per unit area.

NemiM [27]

Answer:

Explanation:

The population density of an area is a demographic tool used to measure the number of organisms or individuals in a particular area.

It is expressed as;

Population density = $\frac{number of organisms}{area of the place}$

The unit is expressed as organisms/km²

An area with a high population density is often not desirable as it can lead to pressure on amenities and infrastructure.

3 0

3 years ago