1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ann [662]
3 years ago
10

What types of life could be on other planets ? Marking branliest !

Biology
2 answers:
Amanda [17]3 years ago
5 0

Organisms that do not depend on oxygen for survival can be found on other planets.

<h3>Could life exist on other planets?</h3>

The solar system is composed of the earth and other planets having the sun as the center. This model is what we generally refer to as the heliocentric model of the solar system.

Life does exist on other planets apart from earth. However, in other planets, oxygen is in limited supply hence only the organisms that do not depend on oxygen for survival can be found on other planets.

Learn more about living things: brainly.com/question/17074249

Tresset [83]3 years ago
5 0

Answer

there are some convincig observatios that there could possibly be life on other planets. scientists are currently working with Nasa in attempts to discover any signs or indications of primitive life beyong Earth. hese signs may be detections of oxygen, or water vapor. if other planets can chemically support life, some forms of simple/primitive life are prokaryotic life forms, bacteria, microorganisms, or even invertebraes!

You might be interested in
Unlike T lymphocytes, B lymphocytes
suter [353]

The correct answer is (c) discover antigens in body fluids.

B lymphocytes act as antigen presenting cells that recognizes and displays the antigen to the white blood cells. These cells process the antigens that are present in body fluids. Professional antigen presenting cells includes B-lymphocytes, macrophages, dendritic cells, etc.





4 0
3 years ago
4) Empress Si-Ling Chi observed _________ in her garden.
emmasim [6.3K]
The answer is: B) silkworms.

“While sitting in her garden she deduced the secret of silk by watching the silkworms. She developed the process to remove the thread from the cocoon and set up silk cultivation farms and the weaving of the new cloth.” (Source: http://4kyws.ua.edu/SI_LING_CHI.html)
7 0
3 years ago
What effect might many years of low precipitation have on water supply?
elena-14-01-66 [18.8K]
It may diminish the water supply because not as much water is being added.
7 0
3 years ago
4) Matching.<br><br> A new genetic trait can result from the___of chromosomes during____.
nydimaria [60]

Answer:

A trait is any gene-determined characteristic and is often determined by more than ... by mutated genes that are inherited or that are the result of a new gene mutation. ... A karyotype is a picture of the full set of chromosomes in a person's cells.

Explanation:

6 0
3 years ago
What are the landmasses surrounding the Philippines?​
Nuetrik [128]

Answer:

Eleven islands make up 95 percent of the Philippine landmass, and two of these — Luzon and Mindanao — measure 105,000 square kilometers (40,541 sq mi) and 95,000 square kilometers (36,680 sq mi), respectively.

\\  \\  \\

3 0
3 years ago
Read 2 more answers
Other questions:
  • What causes the collapse of a nebula?
    10·1 answer
  • Green plants get their energy they need to make food
    7·2 answers
  • Anywhere between 30–70% of individuals with diagnosed cases of Attention Deficit Hyperactivity Disorder (ADHD) also have some so
    10·1 answer
  • ¿Qué es la transcripción inversa? ¿En qué proceso participa?
    15·1 answer
  • 8.which of the following is NOT a carbohydrate
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • In which case will the object move due to an unbalanced force?
    7·1 answer
  • Please help me. No links and please don’t search this I tried it. The answer doesn’t make sense so yah. I Well mark brainliest
    8·1 answer
  • For plants to use the energy created for growth, reproduction and other
    11·1 answer
  • which star is the closest to the earth? how long does it take for light to travel from this star to earth
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!