1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dafna1 [17]
2 years ago
6

PLSSS HELP IF YOU TURLY KNOW THISS

Biology
2 answers:
Elenna [48]2 years ago
4 0

Answer:

the answer is D because technology is what technicians work on

marysya [2.9K]2 years ago
3 0

Answer:

D shout be it

Explanation:

You might be interested in
Lisa was wearing her lab coat, closed-toed shoes, and gloves, and she had her hair pulled back. She wore her contacts to class,
Maru [420]
She shouldn't have worn contacts to class.
8 0
3 years ago
The discovery of the cell was possible due to the invention of what?
shutvik [7]
The discovery of the cell was possible do to the invention of the Microscope.
6 0
3 years ago
Read 2 more answers
How are AIDS and HIV related?
mario62 [17]
They are both types of STD's
8 0
3 years ago
Read 2 more answers
Write a paragraph as if you are a molecule of carbon dioxide in the blood that will be excreted through the lungs. Start in the
schepotkina [342]

Carbon dioxide (chemical formula CO2) is a colorless and odorless gas that is vital to life on Earth. This naturally occurring chemical compound is made up of a carbon atom contently double bonded to two oxygen atoms. Carbon dioxide exists in Earth's atmosphere as a trace gas at a concentration of about 0.04 percent (400 ppm) by volume.Natural sources include volcanoes, hot springs and geysers, and it is freed from carbonate rocks by dissolution in water and acids. Because carbon dioxide is soluble in water, it occurs naturally in groundwater, rivers and lakes, in ice caps and glaciers and also in seawater. It is present in deposits of petroleum and natural gas.

spent a few minutes on this

6 0
2 years ago
Cross-over involves the exchange of genetic information between
Ksju [112]

2 Homologous chromosomes in meiosis, and then replicate into sister chromatids.

Hope this helps, ( or is clear enough ) if not, comment below please!!!!

3 0
3 years ago
Other questions:
  • If black and white true-breeding mice are mated and the result is all gray offspring, what inheritance pattern would this be ind
    15·1 answer
  • In what type of reproduction do cartilaginous fish lay eggs?
    5·2 answers
  • Which is the most common type of biological vector of human disease?
    14·1 answer
  • Examine the five words and/or phrases and determine the relationship among the majority of words/phrases. Choose the one option
    12·1 answer
  • Determine whether the statements about DNA are
    14·2 answers
  • Many mammals control their body temperature by sweating. which property of water is most directly responsible for the ability of
    10·1 answer
  • In Bufo marinus, the tongue is attached at the anterior part of the buccal cavity?
    13·1 answer
  • How do cells become cancerous? What are<br> some things special about cancer cells?
    10·1 answer
  • You discover a new organism while investigating a meteor that recently crashed. While observing it,
    10·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!