1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Masteriza [31]
2 years ago
11

Why do water molecules “stick together”?

Biology
1 answer:
fredd [130]2 years ago
4 0

Answer:

Water is sticky and clumps together into drops because of its cohesive properties, but chemistry and electricity are involved at a more detailed level to make this possible. More precisely, the positive and negative charges of the hydrogen and oxygen atoms that make up water molecules makes them attracted to each other.

Explanation:

You might be interested in
The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
olchik [2.2K]

Answer:

According to the  number of sequence on DNA  there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.

Explanation:

DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-

GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-

GAG  UUU  AUC  CCC  AAC  UUG  GCA  UAA  GGU  AGG-

Glutamine,  Phenylalanine,  Isoleusine,  Proline, Asparagine ,   Leucine,  Alanine,   stop codon.  As ribosome reach on stop codon protein synthesis stopped and process aborted.

8 0
3 years ago
Which processes relate to mechanical weathering check all that apply
Natali [406]

Answer:

A. freezing and thawing

B. plant growth

D. abrasion

Examples of mechanical weathering include frost and salt wedging, unloading and exfoliation, water and wind abrasion, impacts and collisions, and biological actions. All of these processes break rocks into smaller pieces without changing the physical composition of the rock.

Explanation:

hope this helps :D

7 0
3 years ago
Read 2 more answers
In the chemical reaction that forms hydrogen peroxide (H2O2), hydrogen and oxygen share electrons, creating ________ bonds betwe
777dan777 [17]

Answer:

The correct answer is - covalent bond.

Explanation:

5 0
2 years ago
Crossing over between non sister chromatids during meiosis is significant in heredity
suter [353]

Crossing over is the main event in meiosis and heredity as it leads to genetic variation.

<h3>What is genetic variation?</h3>

Genetic variation is the changes that take place in the genes of individuals that can lead to the formation of new characters.

it generally occurs in meiosis specifically during crossing over.

Thus, it can be concluded that crossing over between non-sister chromatids during meiosis is significant in heredity as it leads to genetic variation.

For more details regarding crossing over, visit:

brainly.com/question/27256451

#SPJ4

4 0
2 years ago
Which layer of the<br> earth has the greatest<br> density? Why?
barxatty [35]

Answer:

The inner core has the highest density

Explanation:

Despite high temperatures should be melting the metals in the inner core, the extreme pressure keeps the earth's inner core in a sold phase. The solid metals make the earth's core very dense, at about 17 g/cm³

3 0
2 years ago
Read 2 more answers
Other questions:
  • Which of the following is an example of an estuary?
    8·1 answer
  • Allele frequency mean
    10·1 answer
  • What are two chemical properties of sodium
    11·1 answer
  • Which of the classes of RNA molecules is associated with the large and small subunits of a ribosome and assists in forming prote
    15·1 answer
  • How can a map of the seafloor be generated using mechanical waves?<br> Please Help!!!
    7·1 answer
  • Which outcome is the main function of the light dependent reaction‘s of photosynthesis
    15·1 answer
  • Food moves through the digestive tract by peristalsis, which is produced by wavelike contractions of _____ muscles.
    13·2 answers
  • Justin is warming a pot of soup on the stove. How is the motion of the particles in the soup different
    8·1 answer
  • Why would different restriction enzymes cut the same DNA molecule into different numbers of fragments
    10·1 answer
  • What is the specific application of reverse transcriptase in the preparation of cdna?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!