1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksley [76]
2 years ago
6

PLEASE HELP!!!!!!!

Biology
1 answer:
Dafna1 [17]2 years ago
7 0

Answer: The answer is A, organs produce hormones that change a child's body into an adult.

Explanation: The endocrine system is responsible for regulating a range of bodily functions through the release of hormones.

Hormones are secreted by the glands of the endocrine system, traveling through the bloodstream to various organs and tissues in the body. The hormones then tell these organs and tissues what to do or how to function.

You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
What serves as a structure in a cell?
Sunny_sXe [5.5K]

Answer:

The cell membrane, or in plant cells, the cell wall

Explanation:

In a plant cell the cell wall helps maintain structure, and in animal cells, the cell membrane regulates what goes in and out of the cell and acts as a structure

8 0
3 years ago
*
snow_tiger [21]
C.2
.........................
5 0
3 years ago
When studying shrimp feeding from hydro-thermal vents at the bottom of the ocean, biologists were surprised that the shrimps rep
I am Lyosha [343]

I believe the correct answer to this question would be:

far beyond the reach of <u>sunlight</u>

Hydrothermal vents are usually located on the most bottom part of the ocean. A hydrothermal is created when there is a fissure in the planet’s surface underneath the ocean. 

4 0
3 years ago
BRAINLIESTTTT ASAP!!!
Irina-Kira [14]
Cellular respiration in algae, as in all organisms, is the process by which food molecules are metabolized to obtain chemical energy for the cell. During the process of photosynthesis, cells use carbon dioxide and energy from the Sun to make sugar molecules and oxygen. These sugar molecules are the basis for more complex molecules made by the photosynthetic cell, such as glucose.<span>
I hope this helps!!!
(Please put as Brainliest answer if you can!!)</span>
7 0
3 years ago
Other questions:
  • Giraffes use their extremely long necks to reach the leaves high up on acacia trees, which other animals cannot reach, giving th
    6·2 answers
  • The majority of americans with diabetes have ____________ , formerly called ____________ .
    9·1 answer
  • Hi! I hope your day is going great. I need some help, please. :)
    7·2 answers
  • Label roles of the phytoplankton
    10·1 answer
  • What section of the brain controls the ability to move your right hand?
    14·1 answer
  • Scientist Year
    6·2 answers
  • Plz help ;-;
    5·1 answer
  • How does the suns energy effects the climate of an area
    10·1 answer
  • What happens when you combine two clear liquid solutions, a thick black solid material forms on the bottom of the beaker.
    11·1 answer
  • Based on the absolute dating of the rock layers in this photograph, what
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!