1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
labwork [276]
3 years ago
14

Please select the correct statement below:

Biology
1 answer:
kolezko [41]3 years ago
4 0

The statement 'glycolysis is the first step in Cellular Respiration and does not require oxygen' is correct. Cellular respiration has three steps.

<h3>Cellular respiration</h3>

Cellular respiration refers to the metabolic series of reactions by which aerobic cells can produce energy in the form of ATP by using the chemical energy stored in the foods.

Cellular respiration has three main stages: glycolysis, the Krebs cycle, and oxidative phosphorylation.

Glycolysis is an anaerobic process that occurs in the cytoplasm, whereas the Krebs cycle and oxidative phosphorylation occur in the mitochondria.

Learn more about cellular respiration here:

brainly.com/question/12671790

You might be interested in
How did 18th- and 19th-Century European imperialism help to cause nationalism in Asian and African countries?
givi [52]
<span>D. It inadvertently united people there to oppose foreign domination

Imperialism gave to the concept of nationalism among its colonies. Revolutions have already started against foreign domination during that time.</span>
4 0
4 years ago
Read 2 more answers
The relatively soft weak layer of rock below the lithosphere is the blank now
Sveta_85 [38]

Answer:

asthenosphere

Explanation: The asthenosphere is a part of the upper mantle just below the lithosphere that is involved in plate tectonic movement

5 0
3 years ago
What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer
Fittoniya [83]
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
8 0
4 years ago
Which organelle supplies the cell with energy?​
rodikova [14]
It’s the mitochondria
5 0
3 years ago
"true or false. the y-axis of a species-area curve indicates the number of species that can be maintained in a specified area of
Delicious77 [7]
The answer is true. The Species-Area Curve lets us to forecast how many species will keep on if the forest is reduced in size by a stated amount. The y-axis specifies how many species can be preserved in an exact area while the x-axis specifies the area of habitat. 
7 0
3 years ago
Other questions:
  • if two eukaryotes participate in lateral gene transfer what will the overall genetic variation of the species? A. Nothing, the g
    5·1 answer
  • Multicellular gametophytes are the product of spores from ____​
    7·1 answer
  • Identify the role of carbon dioxide in photosynthesis.
    14·1 answer
  • The number of in an atom determines the identity of the element
    7·1 answer
  • The process of photosynthesis can be represented by the chemical formula A) C6H12O6 + 6O2 → 6CO2 + 6H2O + energy B) C6H12O6 + 6H
    8·2 answers
  • __________ cells may activate b cells, while _________ cells inhibit the activity of b cells.
    8·1 answer
  • ___________ control all chemical reactions including metabolic processes like photosynthesis and cellular respiration
    10·1 answer
  • Why is water important to life in term of cells?
    8·1 answer
  • Darwin stated
    7·2 answers
  • Maria is writing a summary of the invasive species “Kudzu” Finish Maria’s summary / she is writing a section in the newspaper ab
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!