I guess the wavelength as the period becomes smaller the wavelength will decrease and frequency will increase all the rest should remain the same
Hope that helps
Giraffe is the animal with bottom teeth.
Answer:
Answer is Option B
Explanation:
<em>Chromosome</em><em> </em><em>segregation</em>
<em><u>maybe </u></em><em><u>this </u></em><em><u>might </u></em><em><u>be </u></em><em><u>ur </u></em><em><u>answer </u></em>
Hey There Maiam,
<span>What is the symbol equation for aerobic respiration?
Answer: </span><span>1. </span>Aerobic Respiration<span>. It is important that you learn both the word and chemical </span>equation<span>. In the above </span>equations<span> we see that glucose is broken down by oxygen to release energy with carbon dioxide and water being produced as by-products of the reaction</span>
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
