1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Keith_Richards [23]
2 years ago
5

What bay of the Atlantic Ocean is found between New Brunswick and Nova Scotia in Canada?

Geography
1 answer:
Aneli [31]2 years ago
7 0

Answer:

Bay of Fundy

Explanation:

You might be interested in
In 1–2 sentences, describe a feature that plan (a) shares with the urban planning commonly seen in colonies established by Franc
In-s [12.5K]

Answer:

grid plan

Explanation:

In simple words, The grid plan, also known as the grid street design or stadium design, is a sort of city layout in which routes travel at perpendicular to one another to create a grid. The cost of infrastructure is often higher for regular grid layouts than for layouts with disconnected streets.

These plans are highly evident as they started right from the ancient france and Spain.

8 0
3 years ago
What Transport challenges do Australians face?
Novay_Z [31]
I think the baby kangaroos have a pretty sweet ride they just kinda chill in the pouch till they get where they’re going. If australia got rid of their cars and started implementing more kangaroo friendly roadways perhaps they could create new infrastructure to involve kangaroos in the transportation industry.
6 0
2 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
2. Which of the following provides the MOST energy to Earth's organisms?
Lyrx [107]

no.c sunlight is the answer

5 0
3 years ago
Read 2 more answers
Is Moscow located in the asian part of Russia​
mamaluj [8]
No, it is Russia’s capital city located in the European Part.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Historic Westminster Abbey in London, England, has been damaged by the sulfur dioxide and nitrogen oxide in acid rain. This is a
    13·1 answer
  • Addis ababa is the capital of this african country
    11·1 answer
  • _______ is the point where some region of the lithosphere reaches its ultimate elevation and stops rising. A. Orogeny B. Isostat
    15·2 answers
  • Which is the BEST way to conserve the Earth's forests? A) Ride a bike to work. B) Set up a compost pile. C) Recycle paper produc
    13·2 answers
  • What are tectonic earthquake
    10·2 answers
  • First let 2161965 answer<br> and then you ..
    8·1 answer
  • Find the volume of the radius of a cylinder pipe is 2 ft., and it’s length is 21 ft. ?
    11·1 answer
  • What is a fish? Write down 3 facts about a fish and earn 50 points! ( Very easy!!!!):D
    14·2 answers
  • Why do people in the United States vote the way they do?
    10·2 answers
  • A historian who studies how and why people migrated from Asia to the Americans is most likely interested in
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!