1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stella [2.4K]
3 years ago
11

What outcome would this have on plants and animals

Biology
1 answer:
gavmur [86]3 years ago
4 0

Answer:

All plants and animals on earth engage in a process called respiration. Respiration combines oxygen and the food created during photosynthesis to produce usable energy. One of the byproducts of respiration is CO2, this is the opposite of photosynthesis. It is not unusual for plants to stop taking in carbon dioxide to uptake small amounts of oxygen at night.

In the event that plants cease to take up CO2 all together, they will cease to convert sunlight into carbohydrates, and die. The death of autotrophs would lead to a chain reaction of the death of all higher order organisms. Mankind could survive on food stuffs on hand, but only for a very short time. It has been said that any western society, its members are just 3 meals away from revolution.

Social order would be completely lost during the initial food riots. Once the processed and packaged food supply is exhausted, it would be the law of the dying jungle. The strong and well armed would take from the weak and ill prepared. Livestock and game would be slaughtered as the next to the last food source disappeared. The shear volume of death would foul the water spreading pestilence and disease. In one or two years bands of humans would prey on other humans as they degenerate into cannibalism. There could be a few humans in protected bunkers and hideaways, but they too would eventually succumb to starvation or despair as the world died.

The fact that plants stopped converting CO2 into O2 would be of little consequence. Man would die of hunger 1000 years before oxygen was ever an issue.

You might be interested in
DNA Relicase and DNA Polymerase are both important molecules that play a role in the process of DNA replication What types of mo
IRINA_888 [86]

Answer:

enzymes

Explanation:

7 0
3 years ago
Chromosomes consist of ______ sister chromatids in prophase ii.
Schach [20]
Chromosomes consist of two sister chromatids in prophase ii.
3 0
3 years ago
Explain why eating only plants is more effiecent than eating meat
TEA [102]
There are more different nutrients than meat.
3 0
3 years ago
Which of the following statements describes how these organisms are an example of the cell theory?
Sidana [21]

Answer:

I think it would be the first answer choice

Explanation:

3 0
3 years ago
Which of these are recommended for preventing some std/sti’s
Lelechka [254]

Answer: condom is a very good way to prevent stis

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • How are fish with backbones inside their bodies classified? a.crustaceans b.cephalopods c.mollusks d.finfish e.shellfish
    7·2 answers
  • The ________ extends through the hindbrain, midbrain, and forebrain
    15·2 answers
  • The Sun is the primary source of energy for ecosystems. The Sun emits______ . When an organism obtains nutrients by feeding on o
    13·2 answers
  • What are the differences between the endocrine and urinary system?
    9·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • In what ways are ice, liquid water, stem different ?
    11·1 answer
  • Which statement is true about the cells in multicell organisms?
    15·1 answer
  • Which of these species would you classify as a profundal zone organism?
    12·1 answer
  • HELP
    9·2 answers
  • Can I get a list of all eras and one thing that lived during that era?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!