1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
icang [17]
2 years ago
7

Write components of xylem and phylem ?

Biology
1 answer:
aleksandrvk [35]2 years ago
5 0
  • Xylem contains tracheids, vessels, xylem parenchyma and xylem fibre.
  1. Tracheids: They are elongated, tubular dead cells with tapering end walls.
  2. Vessels: These are also known as trachea. They are elongated, tubular dead cells. They are joined to each other by end to end forming a continuous pipe. The cells are thick and lignified.
  3. Xylem parenchyma: They are also called wood parenchyma. This is the only living tissue of xylem.
  4. Xylem fibre: They are dead cells with thick walled fibre.

  • Phloem consists of sieve tubes, companion cells, phloem parenchyma and phloem fibres.
  1. Sieve tubes: These are elongated, tubular living cells arranged in a row, with their perforated end walls forming a sieve. They are non-nucleated. Their protoplasm are inter-connected through sieve plates. They possess vacuoles.
  2. Companion cell: They are elongated, lens-shaped cells containing dense cytoplasm and prominent nuclei. These cells maintain connection with sieve cells through pits.
  3. Phloem parenchyma: They are living thin walled parenchyma cells.
  4. Phloem fibre: They are also known as bast fibre. They are elongated fibre like sclerenchymatous dead cells with thick walls containing pits and interlocked ends. Phloem fibre are the only dead cells in phloem.

Hope you could get an idea from here.

Doubt clarification - use comment section.

You might be interested in
Which renewable energy is used quite frequently in the u.s. and canada
Serhud [2]
The renewable energy source is Hydroelectricity.
8 0
3 years ago
HELLLLLLP
Mandarinka [93]
Occipital Lobe: most posterior, at the back of the head; the occipital lobe controls
Hope it helps
3 0
2 years ago
Read 2 more answers
At which point in the eukaryotic cell cycle does mitosis occur? a after the G0 phase b before the G1 phase c following the S pha
Blababa [14]

Answer:

After the G2 phase

Explanation:

If you want more information on all the phases, leave a comment and I'll write another answer explaining the purposes of the other phases

7 0
3 years ago
Which of the following cells undergoes mitosis?
lilavasa [31]
I’m pretty sure it’s sperm
8 0
3 years ago
Read 2 more answers
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Other questions:
  • In mitochondria, synthesis of ATP uses a proton motive force that is used to
    6·1 answer
  • Which particle is used to determine the atomic number of an element?
    13·2 answers
  • How do humans use their genes to produce more than 22,000 proteins?
    15·1 answer
  • How is thermal energy and temperature similar
    11·1 answer
  • A client who had injection sclerotherapy for varicose veins is advised to wear compression (support) stockings. what is most imp
    8·1 answer
  • Predict the effects of the following types of gene mutations on the protein encoded by that gene (your answer can be just a few
    6·1 answer
  • Do you need to do math to become a Dentist?
    14·2 answers
  • How old is the Moon?​
    12·2 answers
  • I need help please
    7·2 answers
  • Right handedness(R) is dominant to left handedness(r). If you have two parents that are right handed(Rr) and they have a child w
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!