1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adoni [48]
2 years ago
7

If you placed the celery into a bottle of colored water that was 35% sugar, would the colored water be seen in the celery? Why o

r why not?
Biology
1 answer:
Wewaii [24]2 years ago
3 0

Answer:

yes,The small "vessels" in the celery stalks carry the water and color to the leaves, like the way blood travels through your body.

Explanation:

You might be interested in
1. You are a doctor working at a hospital. You want to test a new drug for cancer patients who are being treated in your hospita
maxonik [38]

Answer:

An experimental group is a group that receives the variable being tested in an experiment. The control group is the group in an experiment that does not receive the variable you are testing.

Explanation:

Control group, the standard to which comparisons are made in an experiment. ... A typical use of a control group is in an experiment in which the effect of a treatment is unknown and comparisons between the control group and the experimental group are used to measure the effect of the treatment.

The control group would be the group you keep control as you would not change anything about it throughout the course of the experiment. The experimental group you would give the experimental drug to.

7 0
3 years ago
What is an experiment
andre [41]
An experiment is a scientific procedure that is used to demonstrate a fact, test a hypothesis or make a discovery
3 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
5 things that happen to your body when you drink sea water
butalik [34]
Difussion,semipermeableand osmosis
7 0
3 years ago
What systems are responsible for moving the gases oxygen and carbon dioxide
alexandr402 [8]

Answer:

Air

Explanation:

Air....

5 0
3 years ago
Read 2 more answers
Other questions:
  • Ethyl alcohol and carbon dioxide are the end products of
    15·2 answers
  • A patient arrives at the office complaining of being dizzy when getting up from a chair. the patient's supine blood pressure is
    9·1 answer
  • If both a mother and a father carry a dominant gene for dark eyes and a recessive gene for light eyes (Bb), what is the likeliho
    11·2 answers
  • That you are scientist studying DNA
    12·2 answers
  • In a sample of yeast dna, 31.5% of the bases are adenine (a). predict the approximate percentages of c, g, and t. explain.
    11·1 answer
  • A subordinate object is of less importance than a dominant object.<br><br> a. True<br><br> b. False
    12·2 answers
  • What would most likely be included in the "Analysis" section of a lab report?
    11·1 answer
  • ______ is a defense mechanism that occurs when group members believe the logical, but false explanation of their behavior.
    6·1 answer
  • Which happened when an essential amino acid is missing from the diet
    5·1 answer
  • Since its inception, the theory of evolution has been the subject of frequent debate. Those who oppose evolutionary theory often
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!