1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkasestr [34]
3 years ago
8

Need Help!

Biology
2 answers:
horsena [70]3 years ago
6 0

Answer:

The very common element in the earth's crust, silicon, is absent in the human body as well as in most life on Earth

KATRIN_1 [288]3 years ago
6 0
Silicone is hard to find else where
You might be interested in
Is the climate exactly the same all over the world
Nimfa-mama [501]
No it's not because the weather changes because of the sun and moon
7 0
4 years ago
Read 2 more answers
The change in time for the first quarter is
Gemiola [76]

Answer:

The change in time for the first quarter is 2.07 seconds.

The change in time for the second quarter is 1.09 seconds.

The change in time for the third quarter is 0.95  seconds.

The change in time for the fourth quarter is  0.81 seconds.

Explanation:

This is for table C

8 0
3 years ago
During fertilization, a __________ and __________ combine to form a __________.
xeze [42]
A sperm and egg combine to make a zygote. (or fertilized egg)

So, the answer would be "A".

I hope this helps!
~cupcake
7 0
3 years ago
Match the organism to the infection: Group of answer choices Streptococcus pyogenes [ Choose ] Varicella zoster [ Choose ] Papil
slavikrds [6]

S. pyogenes causes Strep throat, Varicella zoster causes varicella, Papillomavirus causes HPV, E. faecium cause urinary tract infection B. burgdorferi causes Lyme disease and B. pertussis causes Pertussis.

<h3>What is Bordetella pertussis?</h3>

Bordetella pertussis is a  bacteria from the genus Bordetella that causes a respiratory disease known as Pertussis.

Moreover, Bordetella burgdorferi is another bacteria from genus Bordetella that causes Lyme disease, an illness whose symptoms include fever and fatigue.

In conclusion, Streptococcus pyogenes causes Strep throat, Varicella zoster causes varicella, Papillomavirus causes HPV, Enterococcus faecium cause urinary tract infection Borrelia burgdorferi causes Lyme disease and Bordetella pertussis causes Pertussis.

Learn more about Lyme disease here:

brainly.com/question/12185102

#SPJ1

3 0
2 years ago
in reaction a, each sodium atom gives one electron to a chlorine atom. in reaction b, an isotope of oxygen decays to form an iso
vekshin1
The answer is <span>b.reaction b releases more energy than reaction a releases.

The reaction a is an example of a chemical reaction while the reaction b is an example of a nuclear reaction. 
</span><span>Some main differences between the chemical and nuclear reactions are:
- The nuclear reaction releases more energy per gram.
- The nuclear reaction takes place in the nucleus of the atom, while in chemical reactions include electrons.
- In the nuclear reaction, part of the mass is converted into energy, which </span><span>violates the law of conservation of mass.
</span>
Therefore, the nuclear reaction (reaction b) will release more energy than the chemical reaction (reaction a). 
4 0
4 years ago
Read 2 more answers
Other questions:
  • Describe the relationship between group and individual behaviors in animals.
    8·1 answer
  • Choose all the answers that apply.
    8·2 answers
  • Which of the following is an example of how the respiratory system interacts with the circulatory system to excrete waste?
    10·2 answers
  • What structural difference accounts for the functional differences between starch and cellulose?
    12·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which is part of the theory of evolution by natural selection?
    9·2 answers
  • A scientist performs an experiment to see how plants respond to acid rain. He places the water plants in water of varying pH mea
    9·1 answer
  • Can someone answer i need an answer quickly
    12·2 answers
  • Which of the following is NOT part of the cell theory?
    8·1 answer
  • What is the hotspot i’ll give you brainlist
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!