1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Keith_Richards [23]
2 years ago
11

Give the role of air in an ecosystem

Biology
2 answers:
Stolb23 [73]2 years ago
6 0
The atmosphere provides oxygen and carbon dioxide for the plants and animals in an ecosystem. The atmosphere is also part of the water cycle
Radda [10]2 years ago
3 0

Sustain Life and Growth

Air consists one of the main life-sustaining gas called oxygen. Almost all living things breathe in and breathe out this air. Nitrogen and Carbon dioxide are also other gases that are vital for plants and their growth.

Combustion

Apart from this, air supports burning or combustion. The oxygen present in air help in burning of the fuels to basically carry out activities like cooking food, running industries and vehicles as well as generating heat and electricity.

Temperature Control

Another important aspect of air is that it helps in maintaining the temperature on the earth surface by circulating hot and cold air. Air acts as a conductor of heat as well. Even phenomena such as water cycle are dependent on air.

Supplier of Energy

Air which consists of energy is one of the main suppliers of energy. Living things are made up of cells and these cells extract oxygen within the blood to produce energy usually in the form of ATP. This biochemical generation of ATP is essential to maintain life on the earth.

Photosynthesis

Carbon dioxide, which is a component of air is used by plants during the process of photosynthesis. Here oxygen is also released by plants. And we already know how vital oxygen is.

You might be interested in
How do water molecules act like "little magnets"
alisha [4.7K]
Water molecules bond with each other through hydrogen bonding. This type of bonding is a strong one as compared to other intermolecular forces present. The partial positive of the oxygen attracts the partial positive of the hydrogen so they bind to each other. In this way, they act as little magnets.
4 0
4 years ago
Why is it incorrect to say you are wasting water when you let the faucet
777dan777 [17]

Answer:

Instead, you can say, "If you let the faucet run while brushing your teeth, you re wasting water."

Hope this helps!

8 0
3 years ago
Read 2 more answers
What’s the answer to this
den301095 [7]

Answer:

3 and 4 are most closely related.

5 and 6 are also most closely related.

7 0
3 years ago
The most important renal mechanism for regulating acid-base balance of the blood involves __________.
Taya2010 [7]

Answer:

the kidneys

Explanation:

The kidneys help maintain the acid–base balance by excreting hydrogen ions into the urine and reabsorbing bicarbonate from the urine.

7 0
4 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Other questions:
  • How do plants benefit from cellular respiration?
    13·2 answers
  • Diabetics can now obtain insulin that has been manufactured by what biological advancement? HGP, hybridization, gene splicing or
    8·1 answer
  • What is the relationship between water and the rate of photosynthesis?
    12·1 answer
  • What are some of the Non-market, Environmental values of trees?
    9·1 answer
  • Match the following:
    6·1 answer
  • A scientist is comparing that outer layer of an onion cell to the outer layer of a human cell what is unique about the outer lay
    11·2 answers
  • Different energy sources provide different benefits to individuals and the environment. What are some nonpolluting sources of en
    8·1 answer
  • A sealed Ecosphere is able to perpetually sustain life until what happens? A. Oxygen is depleted. B. The producers use up all th
    8·2 answers
  • Which of the following is NOT a characteristic of urban sprawl?
    15·2 answers
  • What is true of mutualistic relationships among organisms?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!