1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
asambeis [7]
4 years ago
11

If you were using cladistics to build a phylogenetic tree of cats, which of the following would be the best outgroup?

Biology
1 answer:
oksano4ka [1.4K]4 years ago
5 0

Answer: a. Wolf

Explanation:

A phylogenetic tree is a diagrammatic representation in which the premitive living species are compared with the modern organisms on the basis of morphological as well as genetic similarities and differences. Hence, they are separated into distinct groups.

All the given organisms in the options (wolf, domestic cat, lion, and leopard) belong to the vertebrata phyllum. Among the options given all the organisms, except wolf, the other organisms are morphologically close to one other. Thus for constructing a phylogenetic tree for these organisms, wolfs will be an out-group. The other organisms will be the descendent belonging to the same group.

You might be interested in
Inference or Observation?<br> I think this rock is igneous bc it has intergrown crystals.
kipiarov [429]

Inference

you have to have 20 letters so I'll type this random text :))

4 0
4 years ago
Read 2 more answers
There are no major nutritional differences observed in organically and conventionally grown vegetables.
Rashid [163]
The answer to that question would be false as there are major differences between how the food grows as in growth rate, mass, and texture and taste; and what kind of nutrients and chemicals you'd be putting into your body such as conventionally are like GMOed for various reason to make certain characteristics while you maybe also eating chemicals produced thereof because of so that isn't necessarily healthy for you to consume whereas organically grown produce is likely to be smaller and disformed at times, and don't always have abundant crops with the acasional bug. So to answer your question Yes there are major differences between organically and conventionally grown vegetables.
5 0
3 years ago
Which feature is shared by protists, fungi, plants, and animals but is lacking in bacteria?
ANTONII [103]
B, a nucleus. Nuclei are membrane-bound organelles inside eukaryotic organisms. Eukaryotes are protists, fungi, plants, and animal cells. A bacteria is not a eukaryote, it is a prokaryote, so it does not have the membrane-bound structure of the nucleus.

Be careful, though, bacteria still have DNA. It is simply located in the center of the cell and is not encased in a membrane.
7 0
4 years ago
Read 2 more answers
Which scenario would represent in a positive population growth
Delvig [45]

It's the Population Growth

4 0
3 years ago
Identify TWO specific human activities that result in a loss of aquatic biodiversity and explain how each activity lowers aquati
noname [10]

Answer:

Mass Carbon Dioxide and Trash being dumped into the water  

Explanation:

Carbon Dioxide kills the reefs which causes a mass amount of ecosystems being destroyed and animals eating the trash thinking its food which would be put into our systems when we catch these fish and eat them

7 0
3 years ago
Other questions:
  • The client with rapid-cycling bipolar disorder who is about to receive his 1700 hours dose of carbamazepine tells the nurse he h
    13·1 answer
  • The magnitude of an earthquake is a number that represents the what
    10·1 answer
  • 15,000 years ago, when humans were foragers and hunters, what characterized daily life? What were humans eating, and where and h
    6·2 answers
  • Explain why the cell membrane in animal cells is thicker than in plant cells.
    8·1 answer
  • AUUUAACUGUUCUGUCUAGAG
    6·1 answer
  • when the blood has lost ________ and gained ________ __________, it travels back to the heart from capilaried to ______ and ____
    7·1 answer
  • A student attaches a rope to the handle of a chest loaded with few books , books while the other end of the rope is tied to a sc
    5·1 answer
  • Which of the following would best mitigate the environmental impact of a
    6·1 answer
  • Is it enough for a female to have 1 dominant gene, or do both genes have to be dominant for her to have a disease (for example i
    13·2 answers
  • Was Pride Rock a homeostatic environment when Mufasa was in charge or when Scar took over?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!