1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga2289 [7]
3 years ago
14

Analyze the given diagram of the carbon cycle below.

Biology
1 answer:
asambeis [7]3 years ago
5 0

Answer:

Read the answers

Explanation:

1) F means oxygen from plant goes into the atmosphere.

2) Matter is conserved in this process because plants take carbon dioxide from the atmosphere for photosynthesis then produces oxygen into the atmosphere, animals then feed on plants and later the animal's faecal matter is released into the soil and even when animals die, microorganisms in the soil break I down into absorbable form for plants use. which makes matter conserved.

3) Mater is in a circular state from atmosphere to plants to animals to soil then absorbed by plants to restart the process again.

You might be interested in
True or False? The low power objective lens has a greater magnification than the high power objective lens.
Nana76 [90]

Answer: true

Explanation: i said so

5 0
3 years ago
Which layers are part of the thermosphere check all that apply
Klio2033 [76]

ATMOSPHERE LAYERS: Troposphere, Stratosphere, Mesosphere and Thermosphere

hope this helped :) pls give brainiest

3 0
3 years ago
Read 2 more answers
Can u plz tell me five facts about the primary succession?!
scoundrel [369]
1- starts with bare rock
2- takes longer than Secondary succession
3- Volcanic eruptions, glaciers, explosions etc are some ways it starts
4- starts after a disturbance
5- it’s the process of changes in an ecosystem
I hope those are good!
3 0
3 years ago
What’s the difference between Food, chyme and bolus?<br> No goggle answer!
djverab [1.8K]

Answer:

Bolus is the food that is mashed up in your mouth. After it is digested in the stomach, the food is called chyme. Bolus is more alkaline than chyme because it is exposed to alkaline saliva.

Explanation:

8 0
3 years ago
If you were planting a vegetable garden, what should you consider for the time of planting?
zvonat [6]

When planting vegetables it is very important to know the climate of the area, its usual patterns, and how will that affect the growth and development of the crops. The soil quality too is very important, as it is the basis for the development of the root-stock of the crops.

If we have a temperate type of climate, than we have four different seasons, meaning different weather patterns throughout the year. We can take onions, radish, and peppers as vegetables of choice. The onions can be planted in mid-autumn, as they will need more moisture, and they are resilient to low temperatures, thus will not have problems in the winter, and in the spring they will already have the basis so will grow quickly and be larger. The radish can be planet in late winter or early spring, in a period when there is more precipitation. It is not a vegetable that likes high temperatures, so with its quick development, it will be able to develop the tuber by late spring. The peppers can not sustain low temperatures, so they should be planted in late spring. They also like warm weather and lot of water, so it will be needed to water them a lot in the hot and dry period. They will manage to develop and produce the vegetables by the end of the summer, thus not getting damaged by the cold nights in the autumn.

7 0
3 years ago
Other questions:
  • What are the difference between an observation and an inference
    15·2 answers
  • What's the difference between primary succession and secondary succession
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • When two pea plants with Tt genotypes are cross-bred how many short (tt) plants will there most likely be in the new generation
    13·1 answer
  • Select all of the following that are functions of the blood in the human body.
    8·1 answer
  • What are the images that occur when a visual sensation persists for a brief time even after the original stimulus are removed?
    8·1 answer
  • What is cell membrane
    14·2 answers
  • Which of these is an example of how the ocean influences climate?
    11·1 answer
  • How are two processes from photorespiration related?
    7·2 answers
  • The prompt contains several characteristics of cell transport. Which of these applies to facilitated diffusion?.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!