1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tiny-mole [99]
3 years ago
13

I'm learning about photosynthesis and cellular respiration and wonder how cellular respiration works for plants.

Biology
2 answers:
Westkost [7]3 years ago
6 0

Answer:

Cellular respiration converts oxygen and glucose into water and carbon dioxide. Water and carbon dioxide are by- products and ATP is energy that is transformed from the process. Background Information: ... Plants take in carbon dioxide through tiny openings or pores in their leaves called stomata.

Zigmanuir [339]3 years ago
5 0
The energy is used for many different things in the plant. Photosynthesis, glucose creation, and much more.
You might be interested in
True or false sedimentary rock can form for metamorphic rock that has been uplifted
Hitman42 [59]
False
Sedimetary rocks can be formed from changes in igneous rock, and igneous rock can be from changes in sedimentary rock.
4 0
3 years ago
A very rare disease will cause damage to the ribosomes in cells. what would be the direct effect of this disease?
DochEvi [55]

Answer:

A rare disease that causes damage to the cell's ribosomes will have as a direct effect the inability to perform protein synthesis.

Explanation:

Ribosomes are cellular organelles formed by proteins and a type of RNA called ribosomal RNA, whose function is to translate the genetic code of the mRNA codon sequence and convert it into amino acids. This implies the first step for protein synthesis to occur.

<em><u>If a rare disease could structurally or functionally affect the ribosomes, the translation of mRNA into amino acids could not occur, so protein synthesis in the cell would not be possible</u></em>.

The consequences of the lack of protein synthesis involve severe consequences on the structure and function of a living organism.

3 0
3 years ago
Which of the following is an ethical consideration when genetically engineering crops?
seropon [69]

B-Bioprocessing for forestry products.

3 0
4 years ago
Read 2 more answers
Transpiration is the evaportaion of water form
gizmo_the_mogwai [7]

Transpiration occurs on plants. So the answer is D. Leaves

8 0
3 years ago
What molecule that is created during photosynthesis provides energy for cellular processes?
Tanya [424]

Answer: D) glucose

Explanation: 100% sure this is the correct answer.( Also took the quiz and got it right.)

8 0
4 years ago
Read 2 more answers
Other questions:
  • . What type of<br> biomolecule contains the code for making helicase?
    5·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What organism reproduces by cell division rather than meiosis?
    12·2 answers
  • The folded the folded layers of the inner membrane in mitochondria are called
    7·2 answers
  • How do you calculate the total magnification<br> from eyepiece lens and objective lens?
    5·1 answer
  • Explain the conversation of mass during cellular respiration
    12·1 answer
  • How many Hydrogen atoms are in 4H2SO4 ?
    8·2 answers
  • IF A CUBE IS 1CM ON A SIDE, CALCULATE ITS SURFACE AREA. HINT WRITE 2 points
    7·1 answer
  • What type of fog is upslope fog?
    13·1 answer
  • When plants are closer to sunlight photosynthesis occurs
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!