1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ahat [919]
2 years ago
8

You can see some blood vessels on the outside of the hands specially in older people. Are those veins or arteries? How can you c

onfirm your answer?
Explain properly please.​
Biology
1 answer:
Papessa [141]2 years ago
4 0

Answer:

I think this is the answer/ Solution: The blood vessels that we see on the outside of hands especially in older people are the veins because arteries are deeply buried in the skin with several layers. They are superficially present outside the skin.

Explanation:

You might be interested in
Help pls il give brailist if correct
tangare [24]

Answer:

I believe that the answer is A.

Explanation:

This option makes the most sense because of the industrial and agricultural revolutions.

7 0
3 years ago
Organisms need nutrients in order to?
Pie
Organisms need nutrients in order to living organism
6 0
3 years ago
Read 2 more answers
Plssss help out study island
Harman [31]

Answer is A

Hope this helps

7 0
1 year ago
Please help timed quiz ​
faltersainse [42]

Answer:

An underground cavern collapsed

Explanation:

I did research

4 0
3 years ago
40. How is the biodiversity of an ecosystem measured?
Slav-nsk [51]

Answer:

i hope this helps

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • The sugar __________ is found only in milk and milk products.
    15·1 answer
  • What is the reason behind the high surface tension of water
    12·2 answers
  • Evolutionary advancement of arthropods over platyhelminthes
    5·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • The molecular sequence, or blueprint for a protein, is originally carried by which molecule?
    6·2 answers
  • Which process in respiration happens first
    12·2 answers
  • Which of the following correctly matches an organelle and its functions?
    7·2 answers
  • It is estimated that the world human population reached 3 billion people in 1959 and 6 billion in 1999. Assuming a carrying capa
    15·1 answer
  • In one to two sentences, explain why low-pressure systems are associated with bad weather? (2 points)
    7·1 answer
  • Look at this picture! Can you tell what type of stone that is?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!