1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alla [95]
3 years ago
7

All living things have ____ that perform specific functions

Biology
1 answer:
Allushta [10]3 years ago
8 0
All living things have organs that perform specific functions.
You might be interested in
In what conditions can asexual reproduction occur?
Ne4ueva [31]

Asexual reproduction takes a variety of forms. The simplest one-celled organisms may reproduce by binary fission, in which the cells simply divide in half. This form of reproduction creates a clone of the parent, and has the benefit of usually being very quick and energy efficient. For example, bacteria that reproduce by binary fission can give rise to progeny every few hours.


hope this helps


<span><span>
</span></span>
8 0
3 years ago
Read 2 more answers
Your first biology exam is coming up in a few days, and to help you get through a late night study session you buy a package of
mariarad [96]
I believe it would be cellulose but I could be wrong if I am I am sorry
4 0
3 years ago
Read 2 more answers
FIRST ONE WHO ANSWERS THIS QUESTIN WILLLL BEEE MARKED BRAINLIEST.
Crazy boy [7]

Answer: Pushing (compression) causes rocks to produce folds and faults. Like for instance when you are putting away a tent you have to fold it down to the proper size for it to fit back in it's box

6 0
4 years ago
The food web in a diverse ecosystem is...
Sveta_85 [38]
It is complex because of the many organisms in the ecosystem.
4 0
3 years ago
gases can spread out in all directions because a. the particles vibrate in place. b. the particles grow bigger. c. the particles
aksik [14]
The answer is C.
A. The particles vibrate in place is for a solid.

8 0
3 years ago
Other questions:
  • What are TWO functions of citric acid in the feta cheese? What are the TWO functions of agar in the feta cheese?
    8·1 answer
  • Which process can produce the most energy for a cell?
    11·1 answer
  • As an embryo develops, new cells are produced as the result of
    10·2 answers
  • Which statement best explains he relationship between hbs allele frequency and malaria
    8·1 answer
  • Infer why energy is necessary to counteract the diffusion of Na+ and K+ ions across the plasma membrane of a neuron.
    5·1 answer
  • *(I WILL GIVE BRAINIEST TO RIGHT ANSWER)* The diagram below shows a portion of the concept map for the rock cycle: ​
    9·2 answers
  • Which statement about convection is correct?
    10·1 answer
  • Why should a scientist repeat the same experiment several times before reporting the results?
    8·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Describe the importance of regulating blood glucose concentration.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!