1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nimfa-mama [501]
3 years ago
6

2. Tectonic plates can collide to form (Choice 1), subduct to form (Choice 2), and even separate to

Biology
1 answer:
guajiro [1.7K]3 years ago
8 0

Answer:

Choice 2

Explanation:

becuase when the teconic plates comes together they collide and causes earthquakes to happen

Hopes this Helps :)

You might be interested in
PLEASE HELP ME ON BOTH QUESTIONS ASAP!!!!!!!!!
Brilliant_brown [7]

Answer:

the first one is A and the second one is either B or C, sorry I could not be more sure about my answer on that second one

Explanation:

Just trust me please

3 0
3 years ago
Help me answer this please
m_a_m_a [10]

Answer:

Stimulating the brain can enable the benefits of

Explanation:

4 0
3 years ago
Many rainforests are found in the tropics, but only a few are found in cooler temperate zones. What makes a forest a rainforest?
aleksandr82 [10.1K]
I’m pretty sure it is b because
6 0
3 years ago
Do you think that hyponatremia results
inn [45]

Answer:

osmosis

Explanation:

Osmosis is the net movement of water molecules through a semipermeable membrane. The water molecules are not reabsorbed in the intestines and at the kidney nephrons. Increased osmotic pressure can be caused by inadequate production of vasopressin which regulates the amount of water in the body and the one being lost through kidneys, Thiazide diuretics which increases sodium excretion and kidney disorders

Hyponatremia occurs when the body contains too little sodium amounts due to increased fluid intake making sodium to be is diluted. People suffering from severe vomiting or diarrhea lose sodium due increase fluid intake.

7 0
4 years ago
I wonder if fish and marine mammals drink salty water
Valentin [98]

Fish and marine mammals sift out the salt from the water, then they drink it.
8 0
4 years ago
Read 2 more answers
Other questions:
  • The Kingdom Monera has been separated into two domains, the Archaea and the Bacteria. Which of the following was most important
    7·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • What if humans were invertebrates and had skeletons on the outside? What would
    11·1 answer
  • Which of the phyla has bilateral symmetry?
    5·2 answers
  • Echinoderms have
    14·2 answers
  • Please answer the ones on the right in standard notation
    15·1 answer
  • Which pair of properties apply to both mechanical and electromagnetic waves?
    12·1 answer
  • Which aspect of a chemical reaction is affected by enzymes?
    10·1 answer
  • Large ecosystems always have higher biodiversity than smaller ecosystems.<br> True or False?
    15·2 answers
  • The anther contains (a sepals (b ovules (c caroled. Pollen grain
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!