1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stels [109]
2 years ago
7

A person with B- blood could get a transfusion from someone with __ blood.

Biology
1 answer:
solniwko [45]2 years ago
3 0

B positive patients can receive blood from B positive, B negative, O positive and O negative donors.

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Which care practice includes ensuring that trailers are clean, dry, and in good repair, handling animals in a calm and
Natalka [10]
It’s c cause I know and I was just too lazy to type the word lol
3 0
3 years ago
List some organisms observed by charles darwin while reading and voyaging the world
Zielflug [23.3K]
Answer

           Some organisms observed by Charlis Darwin are as follow:

1. Beetles

2. Giant tortoise

3. Mockingbird

4. Rhea

5. Pigeon

6. Sand lady slipper
6 0
3 years ago
This is a biology question I have, What is happening in this image?
Alexeev081 [22]
I don’t really understand the question but i’m assuming that’s there’s a chemical reaction happening when the bicyclist is eating the food to get energy to bike?
7 0
3 years ago
Why is selective cutting not a common strategy for managing forests despite having many benefits?
Marina86 [1]

Answer:

It doesn't preserve Biodiversity.

Explanation:

I took the test.

8 0
2 years ago
Other questions:
  • Food that has been through the digestive process is called
    11·1 answer
  • A force that causes mass movement is called
    11·2 answers
  • If earth is considered a " closed system "
    6·1 answer
  • Air, the gas most commonly used by recreational scuba divers, is composed of:
    15·1 answer
  • Which parts of the water cycle are caused by the force of gravity?
    12·2 answers
  • Which is the thinnest of Earth's spheres?
    12·2 answers
  • Which term is associated with asexual reproduction but not sexual reproduction
    14·2 answers
  • During facilitated diffusion - it is still passive but needs help of proteins to help pass.
    12·2 answers
  • Help fast real ans only no thinking​
    6·2 answers
  • The microscope best for viewing living cells at low levels of magnification is the
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!