1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex Ar [27]
4 years ago
15

A population of snails exhibits two morphotypes- (i) dominant dark color [DD an Dd], and (ii) recessive light color [dd].You obs

erve in a population produces 25% homozygous dominant, 43% heterozygous, and 32% homozygous recessive. If there were 100 individuals in the population, how many dominant alleles are present in the entire population
Biology
1 answer:
Evgen [1.6K]4 years ago
4 0
To find the frequency of the dominant allele;
The following formula p + q = 1; p2 + 2pq + q = 1
DD (D2) = 25% = 0.25
D = ü0.25 = 0.5
The frequency of the dominant allele is therefore 0.5  or 50%. Therefore out of a population of 100 snails.
50/100*100 = 50
50 dominant allele are therefore present in the snail population.
You might be interested in
Identify the two minerals shown that exhibit fracture as a dominant form of breakage
bazaltina [42]
Two minerals that exhibit fracture as a dominate form of breakage are quartz and olivine. <span />
4 0
3 years ago
The image shows an aspect of human culture. which aspect is illustrated in the image?
xz_007 [3.2K]

D. language is the answer

7 0
3 years ago
List two functions of the urinary system
Oxana [17]
Its is to remove liquid waste from the blood in the form of urine, and keep a stable balance of salts and other substances in the blood and produce erythropoietin, hormone that is the formation of ref blood cells. The kidney remove ursa from the blood through this filtering units called nephrons
5 0
3 years ago
Which of the following phrases characterizes alternation of generation in algae?
grin007 [14]
Diploid sporophytic generation alternating with haploid gametophytic generation <span>phrases characterizes alternation of generation in algae.</span>
6 0
3 years ago
Read 2 more answers
4) Explain the term "endoskeleton". 5) What is an exoskeleton?​
Elena-2011 [213]

Answer:

Below

Explanation:

4) An endoskeleton is an internal skeleton made out of mineralized tissue that is attached to muscles as well as enabling movement.

5) An exoskeleton is the external skeleton that supports and protects an animal's body. As an example, a snail's shell is an exoskeleton

Hope this helps :)

5 0
3 years ago
Other questions:
  • What are the students observations and inferences
    12·1 answer
  • Which are replicated during interphase?
    14·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which best describes a semidiurnal tide pattern??? A) Two high tides and two low tides each day B) Two high tides and two low ti
    14·2 answers
  • Pls help!! I’ll mark brainliest!!!
    13·1 answer
  • Inhibitors of microtubule synthesis inhibit mitosis by preventing the formation and function of which of these?
    15·1 answer
  • What are science experimental skills
    10·1 answer
  • Select the correct answer. What are the x-intercepts of this quadratic function? g(x) = -2(x − 4)(x + 1) A. (4,0) and (1,0) B. (
    8·1 answer
  • ( PLEASE HURRY, WILL GIVE BRAINLIEST IF CORRECT )
    10·2 answers
  • Public dissent in America led to a plan being devised to create an independent Philippines, which was established in:
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!