Answer:
The lynx's principal food source is the snowshoe hare. These two species' population cycles are intertwined. When hares are abundant, lynx consume almost nothing else and kill two hares every three days. When hares are sparse, lynx eat mice, voles, squirrels, grouse, ptarmigan, and carrion.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Answer:
Air masses are characterized by their temperature and humidity properties. The properties of air masses are determined by the the underlying surface properties where they originate. ... Upon movement, air masses displace residual air over locations thus changing temperature and humidity characteristics.
Explanation:
Asbestos fiber accumulate in the <em>lysosomes.
</em>
Option: (b)
<u>Explanation:
</u>
Asbestos is a natural group of minerals and it is composed of thin and needle-like fibers. An asbestos causes several diseases like cancers and so on, including asbestosis and mesothelioma.
Although asbestos extend and fireproofs materials, this materials are banned in ‘many countries’. But asbestos are not banned in the United States.
Lysosomes are important part of the ‘endomembrane system’ because lysosomes are formed from the ‘endoplasmic reticulum’ and these products are synthesized and processed by the ‘Golgi’.