1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wolverine [178]
4 years ago
8

Shear causes horizontal movement along a fault plane in a/n _______

Biology
2 answers:
Anna35 [415]4 years ago
8 0
<h3><u>Answer</u>;</h3>

strike-slip fault

<h3><u>Explanation;</u></h3>
  • Shear causes horizontal movement along a fault plane in a strike-slip fault.
  • <em><u>Strike-slip faults are vertical fractures where the blocks have moved horizontally. </u></em>
  • Strike-slip faults are caused by horizontal compression. Strike-slip fault slips release their energy by rock displacement in horizontal direction almost parallel to the compression force.
ladessa [460]4 years ago
6 0
Shear causes horizontal movement along a fault plane in a strike-slip fault.
You might be interested in
What ecological method would you use to see if a water is good to drink
alexgriva [62]
Water quality testing would be the best approach.
5 0
2 years ago
Read 2 more answers
Compare and contrast Meiosis and Mitosis, how are they similar and how are they different?
Ugo [173]

Answer:

Cells divide and reproduce in two ways, mitosis and meiosis. Mitosis results in two identical daughter cells, whereas meiosis results in four sex cells.

8 0
3 years ago
How long will the Jefferson Memorial take to erode completely? Will mark brainliest!
melisa1 [442]

No one knows. There's no confirmation date at the moment. As that comment said, only time will tell.

3 0
3 years ago
Read 2 more answers
In a study published in the journal Nature, scientists studied eight ponds in Florida: four that were populated by a species of
AlexFokin [52]

Answer: the rate of pollination of flower, in a field next to a pond with no fish, will DECREASE.

Explanation:

POLLINATION is defined as the process by which flowering plants, through the aid of external agents such as insects,wind, water and other animals, are able to transfer pollen grains from an anther to a receptive stigma. Insects are the most common pollinators. They visit flowers to obtain nectar and pollen as source of food. Flowers use various features, such as colour and scent, to attract and guide insects to the food source within them. In the process of reaching their source of food, insects bring about pollination.

From the study conducted by scientist in Florida, eight(8) ponds where subjected to the the study. The first four (4) ponds had species of fishes that fed on dragonflies and dragonfly larvae, hence the reason for a decrease in the population of the dragon flies in the area around it. While the remaining four (4) ponds had NO fish and the area around it is populated with dragonflies and dragonfly larvae. This is so because of the absence of fish.

It was then noted that the dragon lies fed of the insect pollinators such as the bees and butterflies. Since these dragonflies and its larvae are abundant in the field which is close to the pond with no fish, they will grossly depend on the insect pollinators as their source of food thereby decreasing the rate of pollination in the field next to the pond with no fish.

7 0
3 years ago
Briefly explain the process of ammonification.
Reptile [31]

Answer:

Ammonification is the process by which the organically bound nitrogen of microbial, plant, and animal biomass is recycled after their death. Ammonification is carried out by a diverse array of microorganisms that perform ecological decay services, and its product is ammonia or ammonium ion.

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • To be a useful index fossil, the organism should have been rare when it lived on Earth.
    13·1 answer
  • The term "myoparesis" is used to describe: weakness or slight muscular paralysis increase in muscle movement protrusion of muscl
    14·1 answer
  • Which is NOT true of lipids?
    11·2 answers
  • When water and mercury are placed in glass tubes, the water in the right tube)
    7·2 answers
  • Where are amphibians that eat living plants most likely to live in a lake?
    15·2 answers
  • Which type of cell is most likely to have the most mitochondria? muscle cells in the legs of a marathon runner nondividing cells
    6·1 answer
  • Which of the following correctly arranges the planets by their orbital speeds from slowest to fastest?
    6·1 answer
  • Which of the following best describes all macromolecules?
    8·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • A man has hemophilia, but his parents do not. Using H for normal and h for hemophilia, give the genotype of his father, mother,
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!