1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lostsunrise [7]
2 years ago
5

Solve the equation. (If all real numbers are solutions, enter REALS. If there is no solution, enter NO SOLUTION.)

Mathematics
2 answers:
lana [24]2 years ago
4 0

Answer:

x = 1

Step-by-step explanation:

\frac { 7 x + 1 } { 16 } = \frac { 1 } { 2 }\\7x+1=\frac{16}{2} \\7x+1=8 \\7x=8-1 \\7x = 7\\x = \frac{7}{7} \\\bigstar \; \boxed{x = 1}

Hope it helps ⚜

abruzzese [7]2 years ago
3 0

Answer: 1

Step-by-step explanation:

16 * 1/2 = 8

7x + 1 = 8

7x = 7

x = 1

You might be interested in
A 12 inch candle and an 18 inch Candle are lit at 6 p.m. The 12 inch candle burns 0.5 inches every hour. The 18 inch candle burn
Stella [2.4K]
18 - 2H = 12 - .5H
Combine the variables
18 - 2H + .5H = 12 - .5H + .5H
18 - 1.5H = 12
Combine the whole numbers
18 - 18 - 1.5H = 12 - 18
-1.5H = -6
Divide by -1.5
-1.5H/-1.5 = -6 / -1.5
H = 4
The answer is 4 hours
7 0
3 years ago
HELP NEEDED ASAP!!! PLEEEEASE HELP!!!
olganol [36]

Answer:

24

Step-by-step explanation:

what is the smallest number which is a multiple of both 8 and 12? so, an multiple of 8 must have 2 as a factor at least 3 times. Similarly, multiples of 12 have at least two 2's and one 3. so we need 2x2x2x3 or 24 if every factor is to be included.

I'm not the best at explaining but you can search google to get the better Idea.

(btw this is for the fist question)

6 0
3 years ago
If 1/4 of x is 16 what is 3/4 of x
salantis [7]
If 1/4 of x is 16, we multiply 16 x 4 which will give us x=64. 3/4 of 64 = 48

6 0
3 years ago
Read 2 more answers
What is the value of the expression (3/7)(-2/5 •9/11)
Alex787 [66]

The answer is 54/385, or 0.14025974025974.

Hope this helps!

7 0
3 years ago
Help, pls. In an algebra test rn
Nata [24]
I cannot see the picture
6 0
2 years ago
Other questions:
  • Melcher used 24% if the memory card on his digital camera while taking pictures at a family reunion. If melcher took 96 pictures
    11·1 answer
  • Which value of x satisfies both -9x + 4y = 8 and -3x − y = 4 given the same value of y?
    7·2 answers
  • What is the intersection of the sets A = {2, 3, 5, 7, 11} and B = {5, 11, 13, 15, 17}?
    6·2 answers
  • How on the earth you do this ?
    12·1 answer
  • What is the distance between P(3,-2) and Q(-5,-2) ?
    9·1 answer
  • Follow these steps using the algebra tiles to solve the equation -5x + (-2) = -2x + 4
    13·2 answers
  • Help me answer 49, ignore number 50 please.
    7·2 answers
  • Mr. May invested $21,000, part at 8% and the rest at 6%. If the annual income for from both investments were equal find the amou
    7·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • -11× (-4) =___<br><br> 44 2/15<br><br> - 44 2/15<br><br> - 49<br><br> 49
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!