Chromatin hope this helped
Answer:
it's D; answer is literally on the little speech bubble in the picture
Explanation:
Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
Answer:
okay gimmie like 5 mins I'll look at them then give u awnser
The greater 'mass' a moving object has, the more kinetic energy it has.
I hope this helped. Please please mark Brainly