1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harman [31]
3 years ago
12

What types of powers are shared by the federal and state governments

Biology
2 answers:
Rainbow [258]3 years ago
8 0

Answer:

concurrent power

Explanation:

this is the power to tax, build roads, and create lower courts.

if this helped give brainilest :)

ohaa [14]3 years ago
5 0

Answer:

In addition, the Federal Government and state governments share these powers:

•Making and enforcing laws.

•Making taxes.

•Borrowing money

You might be interested in
Dna in the nucleus is compacted in large structures called ...
Feliz [49]
Chromatin hope this helped
5 0
3 years ago
Read 2 more answers
According to the diagram on the ticks life cycle, when is the MOST LIKELY time for ticks to attack human hosts?
Irina-Kira [14]

Answer:

it's D; answer is literally on the little speech bubble in the picture

Explanation:

3 0
3 years ago
What is the mRNA transcript if the complementary DNA is TCTGAG?
Ghella [55]

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

3 0
2 years ago
Please answer these Biology questions. I need to pass
Vlad1618 [11]

Answer:

okay gimmie like 5 mins I'll look at them then give u awnser

8 0
2 years ago
The greater the _____ of a moving object, the _____ it has
charle [14.2K]
The greater 'mass' a moving object has, the more kinetic energy it has.
I hope this helped. Please please mark Brainly
5 0
2 years ago
Other questions:
  • What happens when you spray water on a pile of sand
    11·1 answer
  • What is the structure of hemoglobin and how is oxygen bound to it?
    5·2 answers
  • Subjects in experimental and control groups should have matching skills. true or false
    13·2 answers
  • What is the act that put a tax on all public documents?
    15·1 answer
  • What happens during morula
    12·1 answer
  • How large is the visible light portion of the Electromagnetic Spectrum?
    5·2 answers
  • A potential cause of male infertility is a blockage of the vas deferens. The blockage could be due to the build up of scar tissu
    10·1 answer
  • Which organelle is the site for protein synthesis
    5·1 answer
  • What happened to the organisms between the Cretaceous and Tertiary boundaries?
    15·1 answer
  • What is five kingdom classification system?<br>​
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!