1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vesna_86 [32]
3 years ago
12

WILL CHOOSE BRAINLIEST! Needs help with 2-4

Biology
1 answer:
daser333 [38]3 years ago
6 0

Answer:

Explanation:

1. both of I-3 and I-4 are hetero because one of their children have dimples( filled in is dimples)

2. only II-9 can be hom0 because II-8 has a parent who is recessive

3. I-1 and III-12 both have dimples  and are male

You might be interested in
Read the paragraph from the section "Pea Plants And The Punnett Square."
laiz [17]

A pea plant could have one copy of the height gene that coded for “tall” and one copy of the height gene that coded for “short”. The tall allele is “dominant”, and this means that it can mask the other allele.

Answer:

Explanation:

8 0
3 years ago
The planets of the Solar System revolve around the Sun in orbits because of ______.
adell [148]
It’s Gravitational pull
4 0
4 years ago
why are biological dichotomous keys considered to be useful tools rather than taxonomaically significant guides to classifying o
vladimir1956 [14]
In biology, a single-access key (also called "sequential key", "analytical key", or "pathway key") is a key where the sequence and structure of identification steps is fixed by the author of the key. At each point in the decision process, multiple alternatives are offered, each leading to a result or a further choice. The alternatives are commonly called "leads", the set of leads at a given point a "couplet". If the entire key consists of exactly two choices at each branching point, the key is called dichotomous, otherwise it is described as polychromous (or, in false analogy, "polychotomous"). The majority of single-access keys are dichotomous.

I<span>t basically helps them define an animal or plant using specific defining characteristics. </span>
5 0
3 years ago
What is the science of naming and classifying living things?
rodikova [14]

Answer:

C. Taxonomy

Explanation:

7 0
3 years ago
Read 2 more answers
How can plant reproduction be described
choli [55]

Answer:

it cant i dont work for nasa sorry

Explanation:lol sorry building points g

5 0
3 years ago
Other questions:
  • What is the pigment called that protects the body from uv radiation and gives it skin color?
    10·1 answer
  • Bacteria is the simplest of cells. One special feature of bacterial cells that helps it survive in hostile environments is its
    9·1 answer
  • 5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
    10·1 answer
  • In a particular recessive genetic disorder, you find the allele frequency for this recessive allele in a population is 0.02. Ass
    10·1 answer
  • Uses of microorganisms as Biotechnology include which of the following?
    10·2 answers
  • Which is identical in all living organisms?
    5·2 answers
  • An example of a positive feedback loop ________.
    15·1 answer
  • Pet owners begin to abandon their Burmese pythons in the Everglades when they become too large for home care. Native species of
    11·1 answer
  • Which of the following is an organism whose cells each contain a membrane<br> bound nucleus?
    11·1 answer
  • Cannabis concentrates contain significantly more thc than the cannabis plant. Cannabis concentrates commonly have _____ % thc an
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!