1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
attashe74 [19]
2 years ago
5

A ship is stationary at sea. A tugboat is 28 km away at a bearing of 315°, and a yacht is 21 km from the tugboat at a bearing of

210°. Draw a scale diagram showing the positions of the three vessels. Use a scale of 1 : 350,000. Measure the distance from the ship to the yacht to the nearest km.​
Mathematics
2 answers:
alekssr [168]2 years ago
6 0

Answer:

ans is 33.6

Step-by-step explanation:

please mark me as brainlist please I

aleksley [76]2 years ago
3 0

The distance of the yacht from the ship is found by accurately drawing

the relative location of the three vessels.

Response:

  • The measured distance of the yacht from the ship is approximately <u>30 km</u>.

<h3>Which drawing method can be used in which the distance of the yacht from the ship can be measured?</h3>

The given parameters are;

Distance of the tugboat from the ship, a = 28 km

Bearing of tugboat from the ship = 315°

Distance of the yacht from the tugboat, b = 21 km

Bearing of the yacht from the = 210°

Using a scale of 1 : 350,000, we have;

The \ drawing \ of \ a = \mathbf{\dfrac{28,000}{350,000} }= 0.08

The length of <em>a</em> in the drawing = 0.08 m = 8 cm

The \ drawing \ of \ b =  \mathbf{\dfrac{21,000}{350,000}} = 0.06

Which gives;

<em>b</em> in the drawing = 0.06 m = 6 cm

Using the above dimensions and directions, the drawing of the relative

location of the three vessels can be accurately created using MS Word.

From the application, the vector form of the distance, <em>d</em>, of the ship from the yacht is presented as follows;

  • d = 8.655·i + 0.445·j

Which gives;

d = √(8.655² + 0.445²) = 8.67

Which gives;

  • Distance of the yacht from the ship on the drawing is d ≈ 8.67 cm = 0.0867 m

Actual distance = 0.0867 m × 350,000 = 30,345 m = 30.345 km ≈ 30 km

  • The distance of the yacht from the ship ≈ <u>30 km</u>

Using cosine rule, where the angle formed at the tugboat = 75°, we have;

d² = 28² + 21² - 2 × 28 × 21 × cos(75°) ≈ 920.63

Which gives;

d ≈ √(920.63) ≈ 30

The distance of the yacht from the ship, d ≈ 30 km

Learn more about bearings in mathematics here:

brainly.com/question/10710413

You might be interested in
17+36=z-37 what is z
sp2606 [1]

Answer:

The correct answer is 90

Step-by-step explanation:

17 + 36= z- 37   ADD 17 AND 36

53= z-37        BRING 37 OVER TO 53 AND ADD

z = 90           FINAL ANSWER

8 0
2 years ago
Converting 7/8 to a decimal.
Elza [17]
Ok, so if you want to convert 7/8 into a decimal, you just simply divide 7 into 8.  Well that should be 0.875 because 7 ÷ 8 = 0.875 Hope that helped!!!  :)
5 0
3 years ago
Read 2 more answers
A-attached earlobes a-unattached earlobes if a is the allele for having attached earlobes, what percentage of offspring will hav
Scorpion4ik [409]

The percentage of the offspring that will have atatched earlobes as the dominant trait, is: 50%.

What is a Dominant Trait?

A dominant trait surpresses a recessive trait, and expresses itself. The allele of a dominant trait is usally denoted using capital letters.

Given the following traits:

A - attached earlobes (dominant allele)

a - unattached earlobes (recessive allele)

A cross between Aa and aa is shown in the image attached below.

The offspring having attached earlobes = 2 Aa = 50%.

50% of the osspring will have attached earlobes.

Learn more about dominant trait on:

brainly.com/question/16616523

4 0
2 years ago
A teacher conducted an experiment to see if she was more likely to call on boys or girls in class. one day she recorded the numb
sashaice [31]
C i hope it’s right:)
6 0
3 years ago
All parallelograms are _______
KengaRu [80]

Answer:

b) trapezoids

Step-by-step explanation:

a trapezoid has atleast one pair of opposite parallel sides

8 0
3 years ago
Other questions:
  • What would you do first to solve this question: 2+3(x+1)=6x?
    8·2 answers
  • Sam needs to cut a piece of sheet metal into 8 pieces. It takes him 5 minutes to make each cut. How many cuts will Sam Make? Can
    9·1 answer
  • Solve the equation using the zero product principle<br> (x-3)(x+6)=0
    14·1 answer
  • Lim
    5·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • 13. Mr. Robinson is growing carrots in planters that has a width of 4 1/2
    8·1 answer
  • May I please have some help​
    7·1 answer
  • What is 5/6 -3/8 ........
    9·1 answer
  • a random sample of size 100 is taken from a population described by the proportion P equals 0.60 using the appropriate normal tr
    13·1 answer
  • HELP HELP HELP HELP help help
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!