Answer:
1. B. NADH
2. B. hydrolysis of ATP.
3. C. ATP is produced from protein.
4. Option C.
5. Option C. Oxygen
6. Option D. Glucose.
7. Carbondioxide.
8. Metabolism.
9. Electron carriers.
10. Electrons.
Explanation:
Cellular respiration is a series of metabolic processes that break down sugars or food to produce energy. ATP is the cellular energy produced during cellular respiration. Cellular respiration requires oxygen which is also called aerobic respiration. There are stages of cellular respiration and they include; glycolysis, pyruvate oxidation, Krebs cycle or citric acid and oxidative phosphorylation. During cellular respiration, glucose is broken down into carbondioxide and water. Along the way, ATP is produced from the processes that transform glucose.
Explanation:
The root word of Unicellular already tells you the answer. Uni means only one cell. So the answer is one cell.
The greater the amount of active transport carried out by a cell, the greater the amount of mitochondria would be found in the cell.
Active transport uses energy. Mitochondria undergoes aerobic respiration to release large amounts of energy. If the cell is found to be lacking in energy needed for active transport, the cell would adapt by synthesizing more mitochondrion to ensure that it's demand of energy is met.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Solar planet in an undiscovered solar planet. With no other living organisms at its surroundings.
