1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anvisha [2.4K]
2 years ago
8

Which part of the cell membrane is

Biology
1 answer:
Stella [2.4K]2 years ago
5 0

Answer:

it is complicated but you add 1+1 and get two

You might be interested in
A brown bird was crossed with a white one and all of the offspring were tan. Complete a Punnett Square analysis for this pair to
Alex73 [517]

Answer:

here.

Explanation:

The genes coding for colour show codominance. Both the brown and white pigment are equally expressed in the phenotype to give the tan colour.

Considering that the allele for brown pigment is CB and that for white pigment is CW, the genotype for the brown bird is CB CB and that for the white bird is CW CW.

Crossing CB CB × CW CW,

100% CB CW - tan-coloured birds

3 0
3 years ago
(Match the following)
ikadub [295]

Answer:

safashfb nayg8gw4egsfmbasft68awgg

Explanation:gwe4rgwegwegm8uwehg7

Nobody answer this persons question they do this ^^ to many questions just to get points

8 0
3 years ago
Carbon 4 sublimes at a negative 78 degrees Celsius .It 8s called dry ice why is it called dry ice ​
Butoxors [25]
Sublimation is a straight transition from solid to gas. This occurs in dry ice as it the ice, which is a solid state, does melt and have a liquid form. Therefore it is called dry ice as it doesn’t produce any liquid
4 0
3 years ago
What is another name for the photic, or sunlight, zone of the ocean
Alchen [17]

Answer:

sunlit zone or the euphotic zone

Explanation:

The highest layer of the world's seas is washed in daylight during the daytime. This brilliant sea layer is known as the sunlit zone or the euphotic zone (euphotic signifies "sufficiently bright" in Greek) or the epipelagic zone (epipelagic signifies "upon the ocean")

6 0
3 years ago
What is the difference between inductive and deductive reasoning?
murzikaleks [220]
The main difference between inductive and deductive reasoning is that when we're doing inductive reasoning we're trying to create formal rules or formal inferences from a limited set of information, while during deductive reasoning, we're trying to deduce what would happen in a certain case based on general information available. 
3 0
3 years ago
Other questions:
  • List three objects that interact with magnetic fields
    13·1 answer
  • Which structure provides energy to the cell?
    10·2 answers
  • Which of the following interactions is an example of symbiosis?
    13·2 answers
  • What is the density of a liquid that has a volume of 20 mL and a mass of 3 g?
    5·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Carnivores have sharp, pointed teeth that allow them to tear flesh from prey. what type of adaptation is this?
    6·2 answers
  • PLS PLS HELP ITS BIOLOGYYYYY
    12·2 answers
  • Which type of fault creates oceanic rifts and rift valleys?
    10·1 answer
  • 1. Discuss the two types of reasoning and how they are used by scientists to develop and support a hypothesis​
    5·1 answer
  • Describe the relationship between the amount of gill affected and oxygen consumption in the fish for the at rest data set
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!