1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mumz [18]
3 years ago
5

What is the critical difference between gemmulation and fragmentation?

Biology
2 answers:
jekas [21]3 years ago
8 0

Answer: Option D

Explanation:

The gemmulation can be defined as the aggregation of the cells mostly archeocytes when reserve food granules are isolated in a surface of sponge and it is surrounded a protective covering.

The Fragmentation can be defined as a process by which the  asexual reproduction in the multi cellular organism takes place. The fragments of the organism takes place and each fragment grows to form a new individual whose genetic combination is same like its parent.

Hence, the correct option is D

natulia [17]3 years ago
3 0

Answer:

d. Gemmulation involves providing a resistant layer of cells for a capsule; fragmentation is merely breaking off chunks of tissue to grow a new organism

Explanation:

Gemmulation and fragmentation are both a type of asexual reproduction. Gemmulation starts when mass of cell which is produced asexually that are capable of producing a new organism.  

These mass of cells gets surrounded by a protective covering which provide a resistant layer of cell and the structure is called gemmule.

In fragmentation, the parent body part breaks from the whole body and gives rise to a new organism. For example in planaria. So the correct answer is d.

You might be interested in
I don’t understand how to do this
Rudik [331]

Answer:

Translation: GAUGCUUCCAACGACCACTA

Transcription:

GTACGAAGGTTGCTGGTGAT

GATGCTTCCAACGACCACTA

Explanation:

7 0
3 years ago
WILL GIVE BRAINLIEST
givi [52]

Answer:

D. any natural process that threatens human property and human lives.

8 0
3 years ago
What are the complementary RNA strands for this:<br> TAGAGTC
Hitman42 [59]

Answer:

AUCUCAG

Explanation:

T --> A

A --> U (only with rna, when its not rna its T)

C--> G (vice versa)

6 0
3 years ago
Read 2 more answers
Fill in the blanks:- (10marks)
frozen [14]

Answer:

carbon dioxid

I hope it's helps you

6 0
3 years ago
Which statement is true about the cells of non-living objects?
Elena L [17]

Answer:

D

Explanation:

Cells are living things therefore, nonlivng objects do not have cells

8 0
3 years ago
Other questions:
  • For many years, the evaluation of water quality of North Carolina streams was defined in chemical terms, ignoring the biological
    8·2 answers
  • This is a clear version ! Help
    8·1 answer
  • Which category most accurately describes waste such as food wastes, cardboard, cans, bottles, yard wastes, furniture, plastics,
    8·1 answer
  • Stages of development infancy​
    6·1 answer
  • In what way does a specialized cell in a multicellular organism differ from the cell of a unicellular organism
    11·1 answer
  • Refer to the cladogram shown above. The numbers 1 through 5 represent species that exist today. What’s the most recent common an
    11·2 answers
  • A scientist is preparing to use a light microscope in her biology laboratory to view a prepared slide of algal cells.
    12·1 answer
  • Heterotrophs conduct cellular respiration and use what 2 things? *
    12·1 answer
  • Kjdxnjkshicohjdioshco ijdsiochoidshovchdohcoidshiochoixhcoihoxhi oxzhioih ioxho ihzoxh ozhxio hozh
    7·2 answers
  • Some kinds of algae produce toxins.<br> A. True<br> B. False
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!