The coast is warmer and better environment
Answer:
Hummingbird
Explanation:
Pollination is the process by which pollen grains are transferred from anther of a flower to stigma. It is a vital process required for reproduction of new plants.
Cardinal flower has two upper petals and three lower spreading petals. All the petals combine to form a tube at the base. Hence the flowers get a tubular shape. Insects can not enter the tubular flower easily so humming birds usually pollinate these flowers. The hummingbirds feeds on its nectar and pollinates the flower in the process.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: