1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
White raven [17]
2 years ago
6

The cellular machinery responsible for protein synthesis is the:.

Biology
1 answer:
sveticcg [70]2 years ago
3 0
The cellular machinery responsible for protein synthesis is the ribosomes.
You might be interested in
Mantle plumes are areas of hot, upwelling mantle and hot spots develops above these plumes as noted in the map above. Magma gene
harkovskaia [24]
The answer is C) extrusive igneous. This rock starts as magma, so you know it must be a type of igneous<span> rock. The question tells you that the rock forms when it is cooled by the water, so you know it is formed outside of the Earth's interior, therefore making it extrusive igneous rock. </span>
5 0
3 years ago
Some vertibrets maintain their body temperature by breaking down food to water enegry. Sunlight or nutrients
murzikaleks [220]

Answer:

Nutrients

Hope this helps

Explanation:

3 0
3 years ago
Which effect of temperature rise causes a feedback resulting in a rise in global temperature
Neko [114]
Melting ice caps and glaciers
5 0
2 years ago
When are you the most likely to get the flu if you live in North America
nataly862011 [7]

In the United States, flu season occurs in the fall and winter. While influenza viruses circulate year-round, most of the time flu activity peaks between December and February, but activity can last as late as May.
3 0
3 years ago
Read 2 more answers
Which connective tissue cells produces collagen?
shtirl [24]

Answer:

fibroblasts

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • How do your shoulders and elbows move in different ways?
    12·1 answer
  • Why are most earthquakes at plate boundaries?
    15·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • A long time ago, Leslie was stuck in an elevator for over 3 hours. Though generally not claustrophobic, after 2 hours she felt l
    12·1 answer
  • Which has greater solubility: baking soda or table sugar? Why?
    5·1 answer
  • What are the standards that an employer of any country must fulfill to comply with the labor guidelines set by ILO?
    5·1 answer
  • NEED HELP IM TIMED! Asap
    8·1 answer
  • Which explains a difference between prokaryotic and eukaryotic gene reguation?
    11·1 answer
  • What would happen if the air didn't carry water ?
    8·1 answer
  • A kind of variable that a researcher purposely changes in an investigation is
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!