1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marta_Voda [28]
3 years ago
11

How Expotential and logistic growth model similar how are they different

Biology
1 answer:
Nana76 [90]3 years ago
8 0

Answer:

The exponential growth model shows a characteristic curve which is J-shaped while the logistic grown model shows a characteristic curve which is S-shaped. The exponential growth model is applicable to any population which doesn’t have a limit for growth. The logistic growth model is applicable to any population which comes to a carrying capacity.

Explanation:

You might be interested in
Cell organelle crossword puzzle
elena-s [515]

Do you want a crossword puzzle? Sorry I am a bit confused.

3 0
3 years ago
48:47
Sphinxa [80]
I think the answer is c
8 0
3 years ago
Many diseases, cancers and even normal human variations can be caused by mutations and variations in the DNA nucleotide sequence
Harrizon [31]

Answer:

the sequence of the protein's polypeptide would be altered consequently.

Explanation:

Remembering that genetic code is specific i.e. unambiguous. Translation is strictly codon specific and may be redundant. Any genetic alteration invariably affect the sequence of the resulting polypeptide.

5 0
3 years ago
Read 2 more answers
Cranberries and grapes may have therapeutic value. A cranberry company obtained the patent for a process to extract the oil from
Montano1993 [528]

The correct answer is The FDA tests give reliability to the results of improved health obtained by each company.

The testing is one of the things a producer needs to do to assure and establish the safety of any product.

Testing may be done as part of an existing research program or when investigating possible safety problems with a product.

5 0
3 years ago
Which of the following has a PhD in psychology and specialize in the diagnosis and
trasher [3.6K]

Answer:

Psychiatrist

Explanation:

A psychiatrist is a medical specialist who focuses on mental health issues, such as substance abuse. Psychiatrists are trained to evaluate both the mental and physical components of mental illnesses. I hope this helps and if it does a Brainliest would be nice!

6 0
3 years ago
Other questions:
  • What is the definition of ecology?
    7·2 answers
  • Reactions that use energy and synthesize building blocks into macromolecules are part of _______, whereas ______ refers to cellu
    13·1 answer
  • Which cells in the liver perform this function of removing bacteria and foreign material from the portal blood?
    11·1 answer
  • How does having a diverse gene pool help a species survive
    6·1 answer
  • Arrows represent the movement of chemical elements between reservoirs. Which of the following best describes the movement of ele
    5·1 answer
  • Why are mutations in eukaryotic cells recessive
    10·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Each nephron has a slightly coiled tube that has a blank membrane?
    14·1 answer
  • Living things pass hereditary information to new
    9·1 answer
  • Carbon moves out of the
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!