1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katovenus [111]
2 years ago
13

The answer for the question in the picture

Biology
1 answer:
Darina [25.2K]2 years ago
4 0

Answer:

ram ranch

Explanation:

69. basically. when cowboys assemble at ram ranch, they partake in questionable activities.

You might be interested in
How is protein synthesis different in prokaryotes and eukaryotes?
Viktor [21]

Answer:

The correct answer is option B

Explanation:

Translation is the process of synthesis of proteins from mRNA in organisms  and transcription is the process of synthesis of mRNA from DNA.

Both prokaryote and eukaryotes shows the presence of translation but both shows many differences in the process of protein synthesis like site of transcription and translation as in eukaryotes transcription takes place in nucleus while translation takes place in cytoplasm. Since prokaryote lacks the nucleus, both transcription and translation takes place in cytoplasm and lacks the process related to post-translational modifications due to which they take place at the same time.

Thus, option B  is the correct answer.

5 0
3 years ago
Select the correct answer.
iVinArrow [24]

Answer:

intermediate cuneiform

Explanation:

5 0
3 years ago
Where do nutrients enter the body?
Bogdan [553]

Answer:

thru the nucleus or cell wall i think

Explanation:

4 0
3 years ago
Read 2 more answers
Confers with needles growing in clusters generally have how many needles per cluster?
zysi [14]

Answer:

d

Explanation:

4 0
3 years ago
What does the fully charged ATP LOSE to become uncharged?
RSB [31]
It loses a phosphate group. A fully charged ATP will have three phosphate groups. It loses one phosphate group and becomes ADP.
8 0
3 years ago
Other questions:
  • 3. Why are cilia and flagella important?
    10·1 answer
  • Wool yarn can be substituted for the human hair in a hygrometer why would this work?
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Help me plz im stuck
    12·2 answers
  • Richard Caton used electrodes ______.
    6·1 answer
  • Which of the following are atomic ions? Select all that apply.
    5·1 answer
  • Which of the following are examples of what scientists can learn from studying fossils?
    15·2 answers
  • 1. In RNA, the nucleotide ______ is used in place of thymine in DNA.
    14·2 answers
  • Which of the following is a benefit of nonrenewable energy?
    5·1 answer
  • What is electrolyte balance in the body?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!