1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dominik [7]
2 years ago
5

. Give examples of how climate change may lead to the emergence, expansion, and extinction of species.

Biology
1 answer:
Pachacha [2.7K]2 years ago
5 0
Instead, climate change was found to typically lead to local extinctions and declines by influencing interactions between species, such as reducing prey populations for predators.
You might be interested in
Question 2
Vikki [24]

Answer:b

Explanation:it has to be

7 0
3 years ago
What are the top 3 biological study’s
vodomira [7]
Plants, microorganisms, and animals
7 0
3 years ago
Why do scientists use models to study changes to the earth’s surface
Stells [14]
Because it’s time consuming and money consuming to observe from space so models are required
6 0
3 years ago
Which physician specializes in treatment of the gums?
natima [27]
A physician who specializes in treatment of the gums is called a periodontist. 
7 0
3 years ago
Read 2 more answers
Order the steps that occur as a protein is synthesized within a cell and finally excreted for use outside of the cellITEMMove Bo
Elis [28]
Nucleus, mRNA, Rough ER, Ribosome, Golgi Body, Cell Membrane.

This question is kind of tricky since a protein would be within the nucleus AS an mRNA sequence and within the rough ER WITHIN a ribosome.
9 0
3 years ago
Read 2 more answers
Other questions:
  • Which best describes organic compounds
    13·1 answer
  • Why does a hot air balloon rise?
    10·1 answer
  • Opsonization, the process in which some pathogens are coated with antibodies and complement proteins, is representative of which
    9·1 answer
  • Write the name of each technique in the blank beside its description A. ___________________________ produces a record of electri
    9·1 answer
  • How Do You Learn Through Operant Conditioning? Which of the following scenarios illustrate how biology constrains reinforcement?
    15·1 answer
  • Significado gas metano
    13·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Bacteria are able to reproduce very quickly through a process known as binary fission. Binary fission requires only one parent.
    6·1 answer
  • Can someone please put this in there own words?
    12·1 answer
  • Sambhog means what what does it means ​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!