1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Norma-Jean [14]
3 years ago
11

DONT ANSWER WITH LINKS PLEASE!

Health
1 answer:
Rasek [7]3 years ago
6 0
1. Aim to eat healthy foods at least 75% to 80% of the time
2. Eating a well balanced diet means eating a variety-of foods from each of the 5 foods groups daily, in the recommended amounts.
3. Dieting is a short term processes and a lifestyle change to long term.
4. Losing weight a lot can make problems like muscle loss and gallstones etc
5.
You might be interested in
1.
Mars2501 [29]

Explanation:

1). A

2). C

3).C

4).A

5)F= giving fluids may induce vomiting, therefore further damaging the esophagus. In an ER, charcoal is ingested which absorbs chemicals. charcoal is usually ingested by means of a tube straight to the stomach, which is then vacuumed out, or vomiting contents.

3 0
3 years ago
Marking Brainlest Answer !!!!!
DochEvi [55]

The cardiac cycle consists of two phases; a period where the heart muscle is relaxed, called <u>diastole</u>, and a period of contraction, called <u>systole</u>.


These are then divided into four stages. These are;


1.<u>Ventricular Filling Period (VPF)</u>


2. <u>Isovolumetric Contraction Period (ICP)</u>


3. <u>Ventricular Ejection Period (VEP)</u>


4.<u> Isovolumetric Relaxation Period (IRP)</u>


At rest, cardiac diastole lasts for approximately 0.5 seconds, and cardiac systole lasts approximately 0.3 seconds to complete. However, during exercise, when the heart rate is increased the time period of <u>diastole</u> , especially, is reduced.



3 0
3 years ago
———- goals are set by and for an organization’s top management
Aliun [14]

Answer:

Strategic/Tactical/Operational

Explanation:

Strategic goals are set by and for top management of the organization. Tactical goals are for middle managers to focus on the actions necessary to achieve goals. Operational goals are for lower-level managers to tackle shorter-term issues.

5 0
3 years ago
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
What can your BMI tell you about your body?
Phantasy [73]

Answer:

your Body Mass Index measures the fat in adults.

Explanation:

The BMI is defined as the body mass divided by the square of the body height, and is universally expressed in units of kg/m², resulting from mass in kilograms and height in metres.

7 0
4 years ago
Read 2 more answers
Other questions:
  • Kristina works out seven days a week. Lately, she has been tired, and her body aches. If she is overtraining, which training pri
    11·2 answers
  • Which one of the following statements about gender and strength training is TRUE? 1. Men have a lower proportion of muscle overa
    11·2 answers
  • the outer layer of skin that is responsible for the production of melanin and keratin epidermis 2. a protein substance necessary
    6·1 answer
  • What if your poop is green? am i sick or something?!!!​
    9·2 answers
  • How to prevent corona give only only prevention
    15·1 answer
  • What is the common ratio from the above<br>a 2<br>b 3<br>c 4<br>d 5​
    15·1 answer
  • Heart rate for thirteen year old when they dance
    13·1 answer
  • Calling all my simps. how yall doin? yall hurting, do i needa beat someone up?
    13·2 answers
  • Determination of blood gases includes testing an arterial sample for
    8·1 answer
  • What are the ten horseshoe rules?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!