1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mojhsa [17]
2 years ago
5

Gases do not have a definite shape because?​

Biology
1 answer:
Anna007 [38]2 years ago
3 0

Answer:

Gases do not have a definite shape or volume because the molecules in gases are very loosely packed, they have large intermolecular spaces and hence they move around. The force of attraction between molecules is also very less, as a result gases acquire any shape or any volume.

Therefore, gases take the shape of the container and occupy the complete volume of that particular container.

You might be interested in
The gene form of a trait is called a(n)
OLga [1]
I believe it’s a chromosome.
6 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
1. The amount of matter something has is _____.
tino4ka555 [31]

I believe the blank is "mass."

7 0
3 years ago
Read 2 more answers
Explain why it is important for daughter cells to have a full set of chromosomes. Use complete sentences.
Leya [2.2K]
In mitosis a cell divides to form two identical daughter cells. It is important that the daughter cells have a copy of every chromosome, so the process involves copying the chromosomes first and then carefully separating the copies to give each new cell a full set. Before mitosis, the chromosomes are copied.
8 0
3 years ago
How can a child get a chromosome that is totally different from the original chromosomes of both parents
Oduvanchick [21]
This can happen because you have recessive and dominant characteristics passed down. So you can get a totally different chromosome that doesn't come from your parents because your grandparents may have had it or great grand parents, the line keeps going .
7 0
3 years ago
Other questions:
  • Lucia was a longtime smoker, despite the pressure put on her by friends and relatives to stop. when she was recently diagnosed w
    13·1 answer
  • Many living things depend on the ocean currents for food, transportation, and a suitable climate.
    6·2 answers
  • The amino acid Methionine is associated with what codon?
    13·1 answer
  • Waste in high income countries is made up of mostly
    8·2 answers
  • Compaction and cementation of classic sediments result in
    13·1 answer
  • How is plastic made?
    5·1 answer
  • I need help with this
    5·1 answer
  • A person who has only one copy of the sickle cell gene does not have the sickle
    8·1 answer
  • Pregunta 1 de 10<br> ¿Qué es un clado?
    7·1 answer
  • Why does snakes and frog goes for winter sleep?plz help me fßi need it's and know​
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!