1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tomtit [17]
2 years ago
9

What does the countercurrent mechanism accomplish in the nephron loop?.

Biology
1 answer:
Maru [420]2 years ago
6 0

Answer:

The counter-current multiplier or the countercurrent mechanism is used to concentrate urine in the kidneys by the nephrons of the human excretory system. The nephrons involved in the formation of concentrated urine extend all the way from the cortex of the kidney to the medulla and are accompanied by vasa recta.

You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
What skills or attributes make you a good environmental scientist
alisha [4.7K]

Answer:

Written and oral communication skills.

Teamwork.

Problem solving.

An investigative mind.

Observation skills and critical thinking.

Innovative thinking.

Good with statistics.

Commercial awareness.

6 0
3 years ago
Which of the following is necessary for the light-independent reactions to proceed?
Yanka [14]

Answer;

C) ATP

Explanation;

-Photosynthesis can be divided into two parts: the light-dependent reactions and the light-independent reactions (also referred to as the "dark" reactions).

-The two products of the light-dependent reactions of photosystem are ATP and NADPH.  The movement of high energy electrons releases the free energy that is needed to produce these molecules.  The ATP and NADPH are used in the light-independent reactions to make sugar.

-The light-independent reactions, or dark reactions, of photosynthesis are chemical reactions that convert carbon dioxide and other compounds into glucose. These reactions occur in the stroma, the fluid-filled area of a chloroplast outside the thylakoid membranes.

8 0
3 years ago
The concept of evolution by way of natural selection is a central tenet in biology that has been tested in numerous ways by many
Anna [14]
A. Evolution is a scientific theory, and scientific theories have many hypothesis and experiments that support their findings.
8 0
2 years ago
Which of the following proteins are synthesized by bound ribosomes? Select all that apply.
astra-53 [7]
<span>The first response is correct. All these proteins are synthesized by ribosomes, and if you mean ribosomes bound to the ER, then at least ER Protein, INSULIN, and LYSOSOMAL ENZYME are correct.</span>
6 0
3 years ago
Other questions:
  • A patient diagnosed with breast cancer responded by gathering information about treatment options and becoming involved in a sel
    14·2 answers
  • 32. As gradient increases, what happens to the<br> distance between isolines?
    10·1 answer
  • During dna replication two extra guanine bases are added to the dna. what type of mutation is this
    12·2 answers
  • Select the one true statement.
    9·1 answer
  • Name the organs in the digestive system where there are stratified epithelia.
    6·1 answer
  • Which statement shows an example of how human activities can directly change the equilibrium of an ecosystem? A. A cold front mo
    8·2 answers
  • In an effort to bring mean arterial pressure back to normal after a hemorrhage, total peripheral resistance ________ because the
    6·1 answer
  • How did scientists draw boundaries around the plates?
    8·1 answer
  • Afforesting is a positive effort in curbing the over use and destruction of natural forests
    10·1 answer
  • Select the answer choice that is
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!